Ali Et Al Res Dim.pdf

Research Dimensions January 2011

EFFECT OF LIGHT, NITRATE, AND TUNGSTATE ON THE ACTIVITY OF NITRATE REDUCTASE IN RICE A Ali1*, S Sivakami2, N Raghruam3 1

Department of Biotechnology, National Institute of Pharmaceutical Education & Research, Hajipur, Bihar, INDIA 2 Department of Life Sciences, University of Mumbai, Mumbai, Maharashtra, INDIA 3 School of Biotechnology, GGS Indraprastha University, Delhi, INDIA *Corresponding author – [email protected] (Mob: - +91 9939176001) ABSTRACT Several approaches such as molecular genetics, functional genomics, recombinant DNA technology etc. have been used to elucidate the regulation of nitrate assimilation in plants and microbes. In the present study a combination of enzyme inducers and inhibitors were used to examine the modulation of nitrate reductase in the shoots of 12-days hydroponically (nutrient starved for 10-12 days) grown rice seedlings. First the effect of nitrate and light was checked on the activity of nitrate reductase (NR). Nitrate caused an increase in the NR activity by several fold in both light and dark Light augmented the effect of nitrate. However there was no change in the level of NR mRNA after withdrawal of light signals. Tungstate, an analog of molybdate, caused a severe decrease in the activity of nitrateinduced nitrate reductase even at a very low concentration (0.1mM). These results indicate that the nitrate reductase is regulated in a co-ordinated manner by light and nitrate in rice. Keywords: nitrate assimilation, inhibitors, Tungstate

enzyme

Introduction Nitrogen is often considered to be one of the most important factors limiting plant growth in natural ecosystems and in most agricultural soils. Since last few decades there has been

an excessive and inadequate use of nitrogen fertilizers to meet the requirement of increasing demand of nitrogen for crops. This has lead to an increase in the nitrogen related environmental problems, such as nitrate loss in the environment (Lawlor et al, 2001). Plants can use various nitrogenous forms, nitrate, ammonium, urea, amino acids, and nitrous oxides to meet their nitrogen requirement and this varies from species to species (Forde and Clarkson, 1999). Nitrate, the most preferred source of nitrogen for many plants, is uptaken by energy dependent specific transporters present in the root cells. The nitrate can converted to ammonium in the roots or leaves or transported to the leaves where it is stored in the vacuoles. This conversion of nitrate to ammonium is twostep process catalysed by cytosolic nitrate reductase (NR) and chloroplastic nitrite reductase (NiR). The reduced nitrogen, ammonium, is assimilated into the carbon skeleton by the coordinated action of GS/GOGAT in a cyclic manner. The genes and enzymes of nitrate assimilation have been well characterized in many plant species (Forde and Clarkson, 1999). The pathway of nitrate assimilation is highly regulated and the genes and enzymes of this pathway are coordinately regulated with respect to the nitrogen source, the intracellular amounts of reduced nitrogen compounds, lights, hormones, and carbon status (Stitt et al, 2002). Various approaches have been used to characterize the regulation

Research Dimensions January 2011

of nitrate assimilation. These include pharmacological, immunological, molecular genetics (identification of regulatory genes and mutants), functional genomics, recombinant DNA technology, transgenic plants, as well as use of specific enzyme inhibitors (Stitt, 1999). In the present study one inhibitor, tungstate has been used to study the regulation of nitrate reductase and nitrite reductase in the excised leaves of nutrient-starved rice seedlings. Rice (Oryza sativa ssp. indica var. Panvel I) was a selected to study the regulation of nitrate assimilation because of paucity of the available literature in this field. Rice is also known to be very poor in nitrogen use efficiency; as it uses only ~33% of nitrogen fertilizer applied to the crop resulting in heavy loss of nitrogen. This, in turn, results in drinking water pollution due to leaching of nitrate. Sodium tungstate, an analog of molybdenum, inhibits nitrate reductase and methionine sulfoximine inhibits glutamine synthetase. Tungstate can be substituted for molybdenum in the molybdenum cofactor of nitrate reductase, resulting in inactive enzyme (Deng et al., 1989). Because of its broad biological spectrum of action, tungstate may be used to selectively prevent nitrate reduction. It will be possible to examine the regulation of nitrate uptake and of other steps of the nitrate assimilation pathway in higher plants without the complications introduced by the functioning of the pathway. The results indicate that even a very low concentration of tungstate (0.1mM) is enough to cause severe loss in the activity of nitrate reductase and the extent of inhibition did not increase with increasing concentrations. The findings of the present study clearly indicate that light and nitrate play a significant role in the regulation of nitrate reductase and the regulation of nitrate assimilatory enzymes in rice is similar

to other organisms which use nitrate as the major source of nitrogen nutrient.

Materials and Methods Growth Conditions Rice seeds Oryza sativa var. Panvel I) were washed thoroughly with tap and single distilled water (sd/w), soaked for 10 minutes in 5% v/v sodium hypochlorite (NaOCl) and were washed several times with tap water. The seeds were again washed and soaked in sd/w and kept in dark for two days. Imbibed seeds were plated on wet germination paper in a plastic tray and incubated at 25+2 °C under white light illumination derived from 2 Osram 36 W fluorescent lamps. The light intensity at the plant level was 1 Klux. The seedlings were watered daily with sd/w for 10-12 days. To prevent interferences by nitrate uptake and long distance transport processes with nitrate reduction, most of the experiments were carried out with detached leaves. Induction of NR by nitrate Induction is defined as an increase in enzyme activity above the endogenous level (Aslam et al., 1973). 10-12 days old seedlings were selected for studying the induction of the enzymes by nitrate as maximum NR activity was observed in this period as well as there were no phenotypical stress symptoms like wilting and chlorosis. The seedlings were grown hydroponically (nutrient starved) in order to avoid any kind of metabolic changes contributed by nutrient molecules in the system. Excised leaves were floated on different concentration of nitrate (20-100 mM) in a Petri dish. After 4 hours, leaves were washed to prevent carry over of chemicals, blotted on a tissue paper, wrapped in foil, frozen in liquid N 2

and used immediately or stored at –70° C. Treatment of Tungsate To study the behavioral pattern of enzymes from nutrient starved seedlings, excised leaves were treated with specific enzyme, inhibitors Sodium tungstate (0.5 and 1.0 mM) with or without nitrate and downstream metabolites. After appropriate time intervals leaves were washed, blotted on tissue paper, wrapped in foil, frozen in liquid N2 and used immediately or stored at –70° C.

Research Dimensions January 2011

Enzyme Assays The potassium phosphate buffer (100 mM, pH 7.5) used for preparation of crude extracts contained magnesium acetate (5 mM), glycerol (10% v/v), polyvinylpyrollidone (10% w/v), Triton X-100 (0.1% v/v), Leupeptin (3 mg/l), EDTA (1 mM), DTT (1 mM), PMSF (1 mM), benzamidine (1 mM), and 6-aminocaproic acid (1mM). Benzamidine was prepared fresh before use. DTT and PMSF were added to the rest of the components just before extraction. The leaf tissue (0.25 g) was ground into a fine powder in a mortar and pestle using liquid nitrogen. The extraction buffer was added soon after liquid nitrogen evaporated, but before thawing set in. The tissue to buffer ratio was maintained at 1:3 (w/v) and the mixture was homogenised thoroughly. The extract was filtered through nylon net (80 µm) and centrifuged at 14,000 rpm for 15 minutes. The clear supernatant was transferred into a fresh, pre-cooled microfuge tube and used immediately for the measurement of enzyme activities. Same extract was used for assaying all the enzymes and protein estimation. Nitrate Reductase Assay The assay was performed as described by Hageman (1979) and the nitrite formed was estimated by Snell and Snell method (1949). The reaction mixture consisted of 100 mM potassium phosphate buffer (pH 7.5), 5 mM EDTA, 5 mM KNO and an appropriate amount of crude extract 3

in a total volume of 0.4 ml. The blanks contained all the assay components except NADH. The reactions were set up in triplicate and carried out at RT (25° C) and stopped after 20 minutes by the adding 0.6 ml of 1:1 (v/v) mixture of sulphanilamide (1% w/v in 3 N HCl) and NED (0.1% w/v). The reaction was incubated for a further 15 min at RT and the pink colour developed was measured at 540 nm. The amount of nitrite formed was calculated from a standard graph plotted using the A values obtained from 540

known amounts of nitrite. NR activity was defined as nmoles of nitrite produced per ml extract per hour. The specific activity was expressed as enzyme activity per mg protein, and represented a mean of triplicate samples. Each such experiment was repeated thrice and the

mean data was plotted as relative specific activity (%) along with standard errors. Protein Estimation Protein content was estimated according to the method of Bradford using BSA as standard (Bradford, 1976). RNA isolation RNAwas isolated according to the method of Chomczynski and Sachhi [10] using commercial TRIZOL from GIBCO. Excised leaves were treated with different metabolites and signaling agents either alone and/or with KNO3 up to 2 h. Treated excised leaves were ground thoroughly to a powder using a mortar and pestle in the presence of liquid nitrogen. One millilitre TRIZOL was added immediately, homogenized thoroughly and left for thawing. The tissue to buffer ratio was 1:10 (w/v). The homogenate was left for 5 min at room temperature and centrifuged at 8500 rpm for 15 min at 4 ºC. Chloroform (0.2 ml) was added in the supernatant and the tube was shaken vigorously for 15 s, incubated for 3–5 min at RT and centrifuged at 8500 rpm for 15 min at 4 ºC. The upper aqueous phase containing RNA was transferred to another tube. 0.5 ml isopropyl alcohol was added, left overnight at -20 ºC and again centrifuged at 8500 rpm for 15 min at 4 ºC. The pellet obtained was washed twice with 75% ethanol, dried and resuspended in 50 ml RNase-free (DEPC-treated) distilled water, aliquoted in several tubes and stored at -20 ºC. The quantity of RNAwas measured by taking absorbance at 260 nm and purity checked by measuring the absorbance at 230, 260, 280 and 310 nm. Only that RNA sample was used as template for the RT-PCR which gave a 260/280 ratio of ~2. The integrity of RNA was checked, before performing RTPCR, by agarose gel electrophoresis (0.8%). The gel was stained with ethidium bromide and visualised on an UV transilluminator. RT-PCR and gel analysis RT-PCR was performed in a Techne Progene (UK) thermal cycler fitted with a heated lid. Gene specific primers for NR and tubulin were designed in-house and were also evaluated for various other parameters like melting temperature, presence of secondary structure like

Research Dimensions January 2011

Image analysis of RT-PCR products The RT-PCR gels were photographed with a Canon G2 Digital Camera (Japan) using a yellow filter and gel images were downloaded on a computer. A 100-bp ladder was used to identify the band size of the products. The intensity of the bands was quantified using the image analysis software of Scion Corporation, USA (www.scioncorp.com). The numerical values obtained for different treatments were plotted in the form of Histogram.

Results Nitrate induction

distilled water as a control in light. After 6 hrs, the leaves were frozen and processed for extraction and NR assays. The data presented in Fig. 1 show that 40 mM KNO3 was the optimum nitrate concentration for maximum NR induction in excised leaves. This concentration of nitrate was used for all subsequent experiments. When NR activity was measured from dark-adapted leaves treated with nitrate (40 mM) in dark for 6 hrs, it decreased to 15% compared to that in presence of light (Fig. 2). It can also be seen from the Fig. 2 that in the absence of nitrate, there was no difference in the levels of NR activities between light and dark conditions. 60

Specific Activity

50 40 30 20 10 0 0

20

40

60

80

100

120

Conc. of Nitrate (mM)

Figure 1: Effect of Nitrate Concentrations on NR activity in Light. Excised leaves were floated on different concentrations of KNO3 under white light. Tissue samples were collected at 6 hours following nitrate treatments and processed for enzyme assay. The mean data from three different experiments are shown along with standard error bars. 120

100

R elative Sp. A c. (% )

hairpin and dimer formation using software available on the internet (www.premierbiosoft.com). The sense and antisense primer sequences of NR: AGGGGATGATGAACAACTGC and GAGTTGTCGGAGCTGTACCC. Tubulin sense and antisense primer sequences are TGAGGTTTGATGGTGCTCTG and GTAGTTGATGCCGCACTTGA. The target gene transcript was amplified using one-step RTPCR kit supplied by QIAGEN (Germany), according to the supplier’s instructions. One microgram template and 0.6 mM each of both the primers (forward and reverse) were added into a 50 ml reaction mixture containing 5_ RT-PCR buffer, 5X Q solution, dNTPs and enzyme mix. RNase inhibitor (4 units/reaction) was also added into the reaction mixture. Tubulin was used as a housekeeping control. Cycling conditions were optimised to give a linear relationship between the template used and product formed. Reverse transcription and amplification of the genes were done simultaneously as follows: (1)RT step (50 8C, 30 min, 1 cycle), (2) PCR activation step (95 8C, 15 min, 1 cycle), (3) three-step PCR cycling for 30 cycles involving: (a) denaturation - 94 ºC, 30 s, (b) annealing - 58 ºC, 30 s, (c) extension 72 ºC, 60 s and (4) final extension (72 ºC, 10 min, 1 cycle). PCR products were run on 2% agarose gel and visualized under UV light after staining with ethidium bromide.

80

60

40

20

Effect of Nitrate Concentration Excised leaves were floated on different concentrations of KNO3 (20-100 mM), with

0 W (Light)

W (Dark)

PN (Light)

PN (Dark)

Research Dimensions January 2011

Figure 2: Effect of Nitrate on NR activity in Light and Dark. Excised leaves were floated on 40 mM KNO3 and samples were collected after 6 houra processed for enzyme assays. The mean data from three different experiments are shown along with standard error bars. W: Water PN: Potassium Nitrate (40 mM) Duration of Nitrate Treatment Excised leaves were floated on 40 mM KNO3 and samples were collected and frozen at various intervals (0-10 hrs) for extraction and NR assays. The data presented in Fig. 3 shows that incubation of leaves for 4-6 hrs gave maximum induction of NR by nitrate. This duration of nitrate treatment was maintained for all subsequent experiments. 60

Specific Activity

50 40 30

Excised leaves were floated on 40 mM KNO3 in the dark and samples were collected and frozen after every 12 hrs for 2 days. The data presented in Table 1 shows that NR activity reached a basal level at the end of 12 hrs and remained at that level for the next 48 hrs. A dark-adaptation for 48 hrs was therefore used for further studies. Table 1: Effect of duration of Nitrate Treatment on NR Activity in Dark.

(Concentration of Nitrate – 40 mM) Duration of Nitrate Treatment (hrs.) 0 hr 12 hrs (Dark) 12 hrs (Light) 24 hrs (Dark) 24 hrs (Light) 36 hrs (Dark) 36 hrs (Light) 48 hrs (Dark) 48 hrs (Light)

Specific activity (nmoles nitrite/mg protein/hr) 3.67 6.79 29.7 9.56 15.71 7.97 27.57 6.84 33.9

20 10 0 0

2

4

6

8

10

12

Duration of Nitrate Treatment (hrs)

Figure 3: Effect of Duration of Nitrate Treatment on NR activity in Light. Excised leaves were floated on 40 mM KNO3 and samples were collected at 2 hour intervals and processed for enzyme assays. The mean data from three different experiments are shown along with standard error bars.

Effect of Nitrate on NR mRNA in Light and Dark The effect of nitrate was checked on NR transcript levels in light and the dark. As seen from Figs. 4 (A, B & C), the steady state level of NR mRNA showed a significant increase in the presence of nitrate compared to water treated leaves both in the light and dark. However there was no difference between the extent of induction in light and dark (Figs. 4B & C).

Research Dimensions January 2011

Lane 1. Control Lane 3. Control Lane 2. KNO3 (40 mM) Lane 4. KNO3 (40 mM) Lane M. Marker (B) & (C) – Image Analysis using Scion Image. Transcript level in the presence of 40 mM KNO3 was considered as 100% control.

(A) 120 100

) % (l e v e80 L t ip rc s60 n a r T e v tia40 le R

Effect of Tungstate

20 0 Contr ol

Nitrate

120

100 ) % ( le 80 v e L t ip rc 60 s n a r T e 40 v it la e R 20

Excised leaves were floated on 0.1 and 0.5 mM tungstate and combinations of tungstate and potassium nitrate (40 mM) with controls using distilled water and 40 mM KNO3. After 6 hrs, the leaves were frozen and processed for extraction and enzyme assays. The data presented in Figure 5 show that tungstate inhibited NR activity by more than 80%. It can be also seen from the data as low as 0.1 mM tungstate was sufficient for inhibition and this did not increase with increasing the tungstate concentration (0.5 mM). 120

0 Control

Nitrate

R e la tiv e S p . A c . (% )

100

(B) (C) Figure 4: Effect of Nitrate on NR mRNA in Light and Dark. (A) – Agarose Gel Electrophoresis of RTPCR products from Total RNA isolated using TRIZOL. The gels were stained with Ethidium Bromide and photographed using Canon Camera. Each experiment was carried out in replicates. Lane 1 & 2 – Light Lane 3 & 4 – Dark

80

60

40

20

0 W

PN

0.1 mM T

0.5 mM T 0.1 mM T + 0.5 mM T + PN PN

Research Dimensions January 2011

Figure 5: Effect of Tungstate on NR activity. Excised leaves from 11-day old rice seedlings were floated on Tungstae (0.1 and 0.5 mM) in combination with 40 mM KNO3 (PN) in the light. Activity in the presence of 40 mM KNO3 was considered as 100% control. The mean data from three different experiments are shown as relative specific activity (%) along with standard error bars. PN – Potassium Nitrate (40 mM) W– Water T - Tungstate (0.1 and 0.5mM)

Discussion Nitrate reductase is one of the most studied enzymes, since it is considered as a controlling step in nitrate assimilation. It is a structurally and functionally complex enzyme and its regulation involves a number of different processes. NR was isolated from plant tissues by Evans and Nason as early as 1953. Since then a lot of studies have been done and an impressive number of papers devoted to its studies. The fact that nitrate is required for the induction of nitrate reductase in rice was first demonstrated by Tang and Wu (1957). Since then considerable progress has been made in the understanding of physiology, biochemistry and molecular biology of nitrate assimilation in plants, fungi and algae. The expression of the components of this pathway, namely, nitrate transporters, nitrate reductase and nitrite reductase, is known to be regulated by the end products of nitrate assimilation pathway in addition to environmental signals like sugars, light, and hormones (Sivasankar et al., 1997; Vincentz et al., 1993). Although the biochemistry and molecular biology of nitrate and nitrite reduction are well documented, the regulation of these processes at the levels of transcription and enzyme activity are not fully understood. Control of NR gene

transcription facilitates long-term responses to the nitrate signal (hrs to days), whereas post-translational regulation allows rapid changes in NR activity (mins to hrs). In the present study, attempts were made to examine the induction of nitrate assimilation enzymes by nitrate and light. As there have been no reports on the regulation of the enzymes of nitrate assimilation for this variety of rice, O. sativa ssp indica var. Panvel I, the first set of experiments was carried out to standardize the induction pattern, i.e., the amount of nitrate required and the induction time for the optimum activity of nitrate reductase. All the experiments were carried out with excised leaves as the major site of nitrate assimilation is leaf in most of the crops. From a range of potassium nitrate tested, 40 mM was found to be the optimum concentration for the induction of the enzyme in excised leaves. NR activity declined when higher concentrations of nitrate were supplied to the leaves. The exact reason for this decline is not known but it may be due to accumulation of inhibitory concentrations of downstream metabolites. NR activity was induced several fold by nitrate in the presence of light whereas only trace amounts were detected when the induction was carried out in the dark using dark-adapted leaves. When the leaves were treated in the presence of light with 40 mM nitrate for different time intervals (2-10 hrs), optimum enzyme activity was obtained between 4-6 hrs which began to decrease after 6 hours. Several mechanisms may contribute to this decline in the activity of NR. These include a dramatic decrease of the transcript level which commences soon after illumination (Matt et al., 2001; Scheible et al., 1997b, 2000) and results in a decline of NR protein as well as activity during the second part of the light period (Scheible et al., 1997b) and post-translational inactivation

Research Dimensions January 2011

of NR in the dark (Kaiser and Huber, 1994; MacKintosh, 1998; Scheible et al., 1997b). As a result, the rate of nitrate reduction falls several folds in the second part of the light period, and is negligible during the night (Matt et al., 2001). Changes of the cytosolic NADH concentration might also affect in vivo NR activity (Kaiser et al., 2000). When plants are grown in day/night conditions, the increase in total NR activity during the first 3 h of the photoperiod indicates that the translation of NR is stimulated by light. The possibility that the activity increased in the light due to higher stability of the NR protein has previously been ruled out for N. plumbaginifolia (Lillo et al., 2003). Light stimulation of the translational process is therefore the most likely explanation. It has been shown earlier that in plants grown in light and in the presence of nitrate, the levels of mRNA, proteins and NR and NiR activities decreases slowly after 2 days in darkness. When such plants are returned to light, the mRNAs of NR and NiR are rapidly reinduced to their maximum level after 4 to 6 hrs. This process is independent of phytochrome (Faure et al., 2001). In the present study NR activity reached to the basal level after 12 hrs in darkness probably because plants were not supplied with nitrogen source as well as any other nutrient. When nitrate was supplied to these darkadapted leaves in the presence of light, NR and NiR activities increased to 20 and 3-fold respectively. A comparison of steady state NR mRNA levels revealed statistically significant increases in mRNA both in the light and dark. The extent of increase in the mRNA level (~40 %) in the presence of nitrate as compared to water control was similar in light and dark. However, when NR activities were compared, it was found that difference between water control and nitrate treated

leaves was much higher in the light than in the dark. Besides, NR transcript was detected from the dark-adapted leaves even in the absence of nitrate and light under conditions when no NR activity could be detected. Hence it appears that though NR transcription was not dependent on the presence of light, NR activity was stimulated to a far greater extent by light. It has been reported by other groups of workers in other plants that light and nitrate had cumulative effects on NR mRNA levels (Vincentz et al., 1993). However in the present study, it was observed that light did not further enhance the NR mRNA expression already induced by nitrate. This difference can be attributed to the nitrate starved conditions in which the rice seedlings were grown. It appears that posttranscriptional effect of light is a major factor in controlling the level of NR. A similar kind of NR regulation has been shown in N. plumbaginifolia transgenic plants expressing NR gene under the control of a constitutive 35S promoter (35S-NR) (Vincentz et al., 1993). There was a significant reduction in both protein and NR activity in the dark whereas the level of mRNA remained comparable to that observed for plants exposed to light. Both protein level and NR activity were reinduced totally when the plants were reexposed to light and partially when the plants remained in the dark and received sucrose. This post-transcriptional effect can be explained by modifications in the capability of mRNA to be translated, in the stability of protein, or in the inactivation of the enzyme by phosphorylation. Tungstate can be substituted for molybdenum in the molybdenum cofactor of nitrate reductase, resulting in inactive enzyme (Deng et al., 1989). In the presence of tungstate, NR protein is still synthesized, but the NADH‐nitrate reducing activity is defective. Since treatment of plants with tungstate inhibits the formation of new active

Research Dimensions January 2011

NR,

the

decrease

in

NR

activity

in

tungstate‐treated plants reflects the actual rate of NR degradation. This is a method of studying NR degradation per se with no, or little, interference from de novo synthesis of the enzyme. Because of its broad biological spectrum of action, tungstate may be used to selectively prevent nitrate reduction. It will be possible to examine the regulation of nitrate uptake and of other steps of the nitrate assimilation pathway in higher plants without the complications introduced by the functioning of the pathway. In the present study rice NR decreased severely and reached to almost level after 6 hrs of treatment with tungstate. In another study when Nicotiana tabacum plants were supplied with tungstate, NR activity declined, whereas NR protein accumulated. NR mRNA level normally exhibited a day-night fluctuation; in tungstate fed plants, this day-night fluctuation was abolished and NR mRNA level remained high (Deng et al., 1989). Lillo et al (2004) has also reported that when plants were treated with tungstate, NR activity decreased almost as rapidly in light as in darkness. There are very few reports in the literature related to the studies on the nitrate assimilation pathway in the rice. This plant has been assumed to use ammonia preferably as the nitrogen source. Therefore this study was undertaken to understand the role of nitrate and light in the regulation of nitrate reductase in rice. It can be concluded from the results presented in this paper that rice has almost similar kinds of regulatory patterns observed with other known nitrate assimilating plants.

Reference Aslam, M., Huffaker, R.C., Travis, R. L. 1973. The interaction of respiration and photosynthesis in induction of nitrate reductase activity. Plant Physiol. 52: 137-141.

Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of proteins utilising the principle of protein dye binding. Anal. Biochem. 72: 248-254. Chomczynski, P., Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 9: 167-172. Deng, M. D., Moureaux, T., Caboche, M. 1989. Tungstate, a molybdate analog inactivating nitrate reductase, deregulates the expression of the nitrate reductase structural gene. Plant Physiol. 91: 304-309. Evans, H. J., Nason, A. 1953. Pyridine nucleotide - nitrate reductase from extracts of higher plants. Plant Physiol. 28: 233-254. Faure, J. D., Meyer, C., Caboche, M. 2001. Nitrate assimilation: nitrate and nitrite reductases. In: Nitrogen assimilation by plants. (MorotGaudry, J. F., Ed.). Science Publishers Inc. Enfield. pp: 33–52. Forde, B.G., Clarkson, D.T. 1999. Nitrate and ammonium nutrition of plants: physiological and molecular perspectives. Adv. Bot. Res. 30: 1–90. Hageman, R.H., 1979. Integration of nitrogen assimilation in relation to yield. In: Nitrogen Assimilation of Plants. (Hewitt, E. J., Cutting, C.V. Eds.). Academic Press, New York. pp: 591611. Kaiser W. M., Huber, S. C. 1994. Posttranslational regulation of nitrate reductase in higher plants. Plant Physiol. 106: 817-821. Kaiser, W. M., Kandlbinder, A., Stoimenova, M., Glaab, J. 2000. Discrepancy between nitrate reduction rates in intact leaves and nitrate reductase activity in leaf extracts: what limits nitrate reduction in situ? Planta. 210: 801–807. Lawlor, D. W., Gastal, F., Lemaire, G. 2001. Nitrogen, plant growth and crop yield. In: Lea PJ, Morot-Gaudry J-F, eds. Plant nitrogen. Berlin: Springer-Verlag, 343–367. Lillo, C., Lea, U. S., Leydecker, M.-T., Meyer, C. 2003. Mutation of the regulatory phosphorylation site of tobacco nitrate reductase results in constitutive activation of the enzyme in vivo and nitrite accumulation. Plant J. 35: 566–573. Lillo, C., Meyer, C., Lea, U. S., Provan, F., Oltedal, S. 2004 Mechanism and importance of post-translational regulation of nitrate reductase J. Exp. Bot. 55(401): 1275 - 1282.