Postgraduate Coursework Student Community

POSTGRADUATE COURSEWORK STUDENT COMMUNITY (BACS80C_5820_POSTGRADUATE_COURSEWORK) > TAKE ASSESSMENT: QUIZ

Take Assessment: Quiz Name

Quiz

Instructions

Answer all questions. Final date for completing the quiz is 17 August 2007.

Multiple Attempts Not allowed. This Test can only be taken once. Force Completion This Test can be saved and resumed later. Question Completion Status: 1

2

3

4

5

6

7

8 9 10 11 12 13 14 15 16 17 18 19 20

21 22 23 24 25 26 27 Question 1

1 points Save Recombinant DNA molecules usually contain the DNA from at least three genomes. For insect cells containing baculovirus with a plant defensin gene, indicate the host, vector, donor and insert. Baculovirus Plant Defensin gene Insect cells

Question 2

A. Vector B. Host C. Insert D. Donor

1 points Save For the human insulin gene in pBR322 growing in E.coli indicate the host, vector, donor and insert. Human Insulin gene pBR322 E. coli

Question 3

A. Host B. Vector C. Donor D. Insert

1 points Save For E. coli containing a BAC with an insert of yeast genomic DNA indicate the host, vector, donor and insert.

E.coli Bacterial Artificial Chromosome (BAC) Yeast

A. Host B. Donor C. Vector D. Insert

Genomic DNA Question 4

1 points Save For pGEX in mouse PC12 cells expressing jelly fish yellow fluorescent protein indicate the host, vector, donor and insert. pGEX Mouse Yellow fluorescent protein gene Jellyfish

Questi on 5

A. Host B. Donor C. Insert D. Vector 1 points

Sav e

Design a forward primer of 20 base pairs to amplify by PCR the 100 base pair fragment shown in bold in the following DNA sequence. CTGTGAAAGGGTCATTTGACTCCCAAAAGGGTCACGACCCATTGAGAACAACTGATGTAGA

CAGTGTATGAACATTCT TGCTAGTACTTGTGTGGTTAATGAGTTTGCTTTGAGCCATTTGAA TAGCTGTATAATAACAC ACTGTATAGTCTTAATTGCTATGTTCGTGTCTCATGATACTGAATATTTTTGTGT GTTTACTTGCCAAGTGTATTTTT TAAAACTTGTTTTTTTGCCTATTTTCAAGTGAAAATTCATGTTACTGTCCTTTTCATTAAT AAATAGATGTACACTAA

Questi on 6

2 points Design a reverse primer of 20 base pairs to amplify by PCR the 100 base pair fragment shown in large letters in the following DNA sequence. CTGTGAAAGGGTCATTTGACTCCCAAAAGGGTCACGACCCATTGAGAACAACTGATGTAGA

CAGTGTATGAACATTCT TGCTAGTACTTGTGTGGTTAATGAGTTTGCTTTGAGCCATTTGAA TAGCTGTATAATAACAC ACTGTATAGTCTTAATTGCTATGTTCGTGTCTCATGATACTGAATATTTTTGTGT GTTTACTTGCCAAGTGTATTTTT TAAAACTTGTTTTTTTGCCTATTTTCAAGTGAAAATTCATGTTACTGTCCTTTTCATTAAT AAATAGATGTACACTAA

Sav e

Question 7

1 points Save Adenine is to DNA as lysine is to:

Question 8

1 points Save Protein is to protease as nucleic acid is to:

Question 9

2 points Save A 1.5% agarose gel was run in TBE buffer. The table shows the distance migrated by molecular weight markers and an unknown sample. Calculate the approximate size (in base pairs, to the nearest 100 base pairs) of the unknown samples. Size of marker (base pairs) 21,200 5,000 3,500 1,900 1,400 900 800 600 Unknown 1 Unknown 2

Distance migrated (mm) 12 18 23 32 39 48 51 62 21 45

Unknown 1: 4400bp Unknown 2: 700bp Unknown 1: 700bp Unknown 2: 3900bp Unknown 1: 3900bp Unknown 2: 1100bp Unknown 1: 1100bp Unknown 2: 3900bp Question 10

1 points Save A laboratory procedure requires you to add a reagent to 7nM. You have a 1uM stock solution available. The final reaction volume is 100uL. What volume of the stock solution should you add? 0.7uL 1uL 2uL 7uL

Question 11

1 points Save A laboratory procedure requires you to add 25pmoles of a reagent.

You have a stock solution of 1uM available. The final reaction volume is 100uL. What volume of the stock solution should you add? 0.25uL 1uL 2uL 25uL Question 12

1 points Save SDS-PAGE is a technique which is used to separate protein from nucleic acids. identify the charge on a protein. separate protein molecules by size. assay enzyme activity.

Question 13

1 points Save Why is RNA more difficult to handle in the laboratory than DNA? It is usually double stranded which makes it harder to copy. It is less stable and more likely to be degraded by nucleases. It contains uracil which cannot be paired with another base. It is found in long molecules which can never be copied completely.

Question 14

1 points Save Primers for PCR are generally supplied as lyophilised powder (ie dried down under vacuum). You have received 75nmoles of a primer. You want to add 20pmoles to your reaction of final volume 20uL. Which of the following procedures would give you the right concentration? Dissolve the dried primers in 750 uL water and add 2uL to the reaction. Dissolve the dried primers in 750uL water then make a 1 in 10 dilution and add 2uL to the reaction. Dissolve the dried primers in 750uL water and add 7.5uL to the reaction. Dissolve the dried primers in 1mL water then make a 1 in 5 dilution and add 7.5 uL to the reaction.

Question 15

1 points Save DNA sequencing requires

Deoxynucleotides and Ribonucleotides Deoxynucleotides and dideoxynucleotides Ribonucleotides and dideoxynucleotides Dideoxynucleotides and deoxynucleosides Question 16

1 points Save What is the catalytic activity of reverse transcriptase? It copies ribosomal RNA in the nucleolus. It makes an RNA copy of a DNA molecule. It converts RNA primers to DNA during replication. It makes a DNA copy of an RNA molecule.

Question 17

1 points Save How is 5-bromo-4-chloro-3-indoyl-beta-D-galactoside (X-gal) used? It is an inducer of beta-galactosidase which is used to initiate transcription of the gene, resulting in a blue colour. It is an essential nutrient which produces blue E. coli colonies when grown in on agar plates. It is an enzyme which allows the detection of lactose in the bacterial medium. It is a substrate for beta galactosidase which results in a blue product after cleavage.

Question 18

1 points Save Why is it important to include a promoter sequence when creating a reporter plasmid? The promoter is the DNA sequence where RNA polymerase binds to initiate transcription. The promoter is necessary for mRNA attachment to the ribosome prior to translation. The promoter is required for correct processing of the RNA prior to translation. The promoter synthesises a primer which is needed to initiate transcription.

Question 19

1 points Save You have discovered a new protein which appears to be an enzyme. What would you need to carry out an assay of this enzyme? DNA, RNA, ribosomes. amino acids, substrate, detection system.

product, coloured substrate, cDNA clone. source of enzyme, substrate, way of measuring product. Question 20

1 points Save A plaque assay would be used to detect recombinant virus. True False

Question 21

1 points Save A southern blot is used to detect specific RNA sequences. True False

Question 22

1 points Save When using the expression of the lac gene to detect recombinant plasmids, colonies containing recombinant plasmids will be blue. True False

Question 23

1 points Save E. coli cells which are competent are those which are blocked from taking up foreign DNA molecules. True False

Question 24

1 points Save What is a restriction enzyme? Select all correct answers. An enzyme which copies DNA A protein which cuts DNA sequences at specific sites. An endonuclease A molecule which restricts access to DNA.

Question 25

1 points Save Select all correct answers. Taq DNA polymerase is: an enzyme which copies DNA into RNA at high temperature. usually found in an organism living at high temperature.

unable to copy DNA at temperatures under 40C. a protein which is stable at 95C. Question 26

1 points Save Which of the following applications would require a cDNA library? Select all correct answers Identifying clones for exons from a gene of interest. Examining DNA copies of genes expressed in a specific tissue. Studying total genomic DNA from an organism. Cloning DNA sequences involved in regulating transcription.

Question 27

2 points Save is an enzyme which forms to a 5' phosphate in a

 

strand

bonds to join a 3' OH