Unit Test Biomolecules.docx

UNIT TEST: BIOMOLECULES Grade 12 Science, Technology, Engineering and Mathematics Name: __________________________________Section: _____________Date: __________ TEST I MODIFIED TRUE OR FALSE. Write TRUE if the statement is correct otherwise change the underlined word to make it true. (2pts each) _________1. Carbohydrates are macromolecules necessary for immediate use of energy, storage of energy, and cell structure. __________2. Saturated fats have two or more double bonds and mostly liquid in room temperature. __________3. Excessive intake of foods rich in lipids can make you prone to respiratory problems. __________4. Nucleic acids are macromolecules necessary for growth and repair of tissues. __________5. A ribozyme is a product of apoenzyme and cofactor. __________6. Proteins are the biomolecules necessary for the storage and transfer of genetic information. __________7. DNA is a long molecule that contains coded instructions for cellular activities such as growth, reproduction, and death. __________8. Organic molecules that make up organism are carbohydrates, lipids, proteins, and fatty acids. __________9. Fatty acids are the single structural units of complex Proteins. __________10. Protein synthesis is an example of anabolism. TEST II MULTIPLE CHOICE. Choose the best answer and write the letter of your choice on the space provided. ____1. What is the monomer of a lipids? a. Nucleic acids b. amino acids c. glucose d. fatty acids ____2. Which type of carbohydrate has an aldehyde as sidechain? a. Aldose b. Ketose c. Lactose d. Pentose ____3. During photosynthesis, what common sugar can be found in most fruits? a. Glucose b. Sucrose c. Fructose d. Maltose ____4. Which of the following bonds is present in DNA? a. Glycosidic bond b. Peptide bond c. London Forces d. Hydrogen bond ____5. What process breaks down a disaccharide to become two monosaccharide? a. a synthesis reaction c. a hydrolysis reaction b. a hydrolytic reaction d. A and B ____6. What common dissacharide is involved in making beer? a. Lactose b. Maltose c. Sucrose d. Galactose ____7. Maltose (wine sugar) is a disaccharide. Which combination produces one molecule of maltose after hydrolysis? a. 2 molecules of glucose b. 2 molecules of glucose + 1 molecule of fructose c. 1 molecule of glucose + 1 molecule of galactose d. 2 molecules of fructose ____8. Which of the following represents the correct ranking from largest to smallest? a. Macromolecule → polymer → monomer → carbon atom b. Polymer → monomer → macromolecule → carbon atom c. Carbon atom → macromolecule → polymer → monomer d. Monomer → carbon atom → macromolecule → polymer ____9. What coats the leaves and stems of plants? a. A triglyceride b. A Phospholipid c. Wax d. Cholesterol ____10. What type of fat contains single bond in its fatty acid chain and is solid at room temperature? a. Saturated b. Unsaturated c. Trans fat d. None of the above ____11. What type of lipids are found in cellular membranes? a. triglycerides b. waxes c. phospholipids d. cholesterol ____12. Which of the following best describes the molecule when double bonds are present in the structure of a fatty acid? a. Fat b. Oil c. Trans fat d. Steroid ____13. What hormone regulates facial and body hair in men and ovulation cycle in women? a. Adrenocorticoids b. Sex hormones c. Cholesterol d. All of the above ____14. A healthy diet promotes a healthy heart. Which food below, when consumed in excess over time, would be most likely to cause heart disease? a. Oatmeal b. Peanut butter c. Butter d. Sugar cane ____15. Which of the following elements does not compose a nucleic acid? a. phosphate b. sugar c. purines d. amino group ____16. What type of protein is described when there are more than 50 amino acids linked together in a chain? a. Protein b. Dipeptide c. Tripeptide d. Polypeptide 1

____17. What category of protein is responsible for movement? a. Messenger b. Storage c. Contractile d. Catalytic ____18. What pertains to a group of nitrogenous bases that links with Pyrimidines? a. Purines b. Styrines c. Pyrimidines d. Hydromidines ____19. What nitrogenous base links with Uracil? a. Cytosine b. Guanine c. Uracil d. Thymine ____20. Which of the following set consists of only nonessential amino acid? a. Alanine, tyrosine, lysine b. Leucine, phenyl alanine, tryptophan c. Alanine, glutamine, lysine d. Alanine, glycine, proline ____21. What is the term for an inactive enzyme not undergoing chemical reaction? a. Holoenzyme b. Apoenzyme c. Proenzyme d. Ribozyme ____22. What enzyme model states that the shapes of the enzyme, active site, and substrate is very specific? a. Lock-and-key model c. Both A & B b. Induced fit model d. None of the above TEST III DNA DECODING. Convert the given coding sequence into an mRNA transcript then list the amino acids excluding the starting and stopping codon. Afterwards, refer to the Codon table below and decode the hidden name. (10pts)

Template sequence:

TACTCCCGGTTGCTACGATTGCTGCGCAGCATAATC

mRNA Transcript: ___________________________________________________________ 1. 2. 3. 4. 5.

6. 7. 8. 9. 10.

___ _____

__A

Believe you can and you’re halfway there – Theodore Roosevelt

2