Analysis Of Genes Isolated From Plated Hemocytes ...

Mar Biotechnol DOI 10.1007/s10126-008-9117-6

ORIGINAL ARTICLE

Analysis of Genes Isolated from Plated Hemocytes of the Pacific Oyster, Crassostreas gigas Steven Roberts & Giles Goetz & Samuel White & Frederick Goetz

Received: 25 April 2008 / Accepted: 21 May 2008 # Springer Science + Business Media, LLC 2008

Abstract A complementary deoxyribonucleic acid library was constructed from hemocytes of Crassostrea gigas that had been plated on poly-lysine plates for 24 h. From this library, 2,198 expressed sequence tags (ESTs) of greater than or equal to 100 bp were generated and analyzed. A large number of genes that potentially could be involved in the physiology of the oyster hemocyte were uncovered. They included proteins involved in cytoskeleton rearrangement, proteases and antiproteases, regulators of transcription and translation, cell death regulators, receptors and their associated protein factors, lectins, signal transduction proteins, and enzymes involved in eicosanoid and steroid synthesis and xenobiotic metabolism. Based on their relationship with innate immunity, the expression of selected genes was analyzed by quantitative polymerase chain reaction in gills from bacterial-challenged oysters. Several genes observed in the library were significantly upregulated by bacterial challenge including interleukin 17, astacin, cystatin B, the EP4 receptor for prostaglandin E, the ectodysplasin receptor, c-jun, and the p100 subunit of nuclear factor-kB. Using a similar approach, we have been Electronic supplementary material The online version of this article (doi:10.1007/s10126-008-9117-6) contains supplementary material, which is available to authorized users. S. Roberts : S. White School of Aquatic and Fishery Sciences, University of Washington—Seattle, 1122 NE Boat Street, Seattle, WA 98105, USA G. Goetz : F. Goetz (*) Great Lakes WATER Institute, University of Wisconsin—Milwaukee, 600 E. Greenfield Ave., Milwaukee, WI 53204, USA e-mail: [email protected]

analyzing the genes expressed in trout macrophages. While there are significant differences between the types of genes present in vertebrate macrophages compared with oyster hemocytes, there are some striking similarities including proteins involved in cytoskeletal rearrangement, proteases and antiproteases, and genes involved in certain signal transduction pathways underlying immune processes such as phagocytosis. Finally, C. virginica homologs of some of the C. gigas genes uncovered in the ESTs were obtained by aligning the ESTs reported here, against the assembled C. virginica ESTs at the National Center for Biotechnology Information. Keywords Hemocytes . ESTs . Pacific oyster . C. gigas . Innate immunity . Bacterial challenge

Introduction In oysters, hemocytes are responsible for cell-mediated defense. Bivalve hemocytes are composed of several subclasses of cells that can be discriminated on the basis of microscopy, flow cytometry, and even functionality (Cheng 1996). The two major classes of oyster hemocytes that are generally recognized include granulocytes (containing cytoplasmic granules) and hyalinocytes (lacking granules). In oysters, hemocytes are involved in nutrient digestion and transport, wound and shell repair, and internal defense against pathogens. A major defense exhibited by hemocytes involves the direct phagocytosis of antigens. During phagocytosis, the hemocyte may recognize or bind to an antigen by the presence of specific lectins either in the hemolymph or in the membrane of the hemocyte (Cheng 1996; Ford and Tripp 1996). Upon contact with antigens,

Mar Biotechnol

hemocytes may also produce reactive oxygen species (ROS) that are believed to be important cytotoxic, antimicrobial factors (Adema et al. 1991). It is assumed that oyster hemocytes possess the biochemical components necessary for ROS production, and this is based on the detection of luminol or lucigenin-derived chemiluminescence when hemocytes are stimulated with agents such as zymosan or Perkinsus (Anderson 1999). While a number of studies have concentrated on the ability of oyster hemocytes to aggregate, encapsulate, and phagocytose antigens, very few investigations have looked at the biochemical products actually produced by hemocytes. It has been demonstrated that oyster hemocytes produce lysozyme (Yoshino and Cheng 1976), and several other enzymes have been shown to be associated with oyster hemocytes including lipase, β-glucuronidase, acid phosphatase, and aminopeptidase (Cheng and Rodrick 1975). Recombinant deoxyribonucleic acid (DNA) approaches have been used to look at the gene products produced by various oyster tissues including hemocytes. A review of recent advancements in the field of bivalve genomics overall is provided by Saavedra and Bachere (2006). Specifically related to oysters, expressed sequence tag (EST) libraries have been made for eastern oyster (Crassostrea virginica) hemocytes (Jenny et al. 2002), for hemocytes obtained from Pacific oysters (Crassostrea gigas) challenged with bacteria (Gueguen et al. 2003), and for C. virginica and C. gigas challenged with Perkinsus marinus (Tanguy et al. 2004). A mixed tissue (including hemocytes) library and ESTs have also been produced for C. gigas (Tanguy et al. 2008). In the study on hemocytes from bacterial-challenged Pacific oysters, a highly expressed gene was a tissue inhibitor of metalloproteinase (TIMP) that has been shown to be very responsive to pathogen stimulation and wounding (Montagnani et al. 2001; Montagnani et al. 2001). Using a targeted gene approach, oysters have also been shown to produce defensin (Gueguen et al. 2003), transforming growth factor β (TGFβ; Lelong et al. 2007), and chitinase-like proteins (Badariotti et al. 2007). Some of these genes have been reported to participate in the immune response of the oyster to pathogen challenge. While there have been additional targeted gene isolations originating from the oyster hemocyte ESTs (Gonzalez et al. 2005; Gueguen et al. 2003), few immune-related genes have been reported in oysters from these or other libraries (Saavedra and Bachere 2006). It appears that in past studies using oyster hemocytes for gene discovery, cells have been isolated from hemolymph by centrifugation and then used immediately for ribonucleic acid (RNA) isolation. Over the past several years, we have developed primary cell culture techniques to obtain trout macrophages from head kidneys (Mackenzie et al. 2003). These primary cell cultures have been used for EST

isolation (Goetz et al. 2004a) and also to investigate pathogen recognition in fish (Iliev et al. 2005, 2006). The technique involves plating cells isolated from the head kidney on poly-lysine plates for incubation. Thus, only adherent cells are used for experimentation. In the present study, we used a similar protocol for Pacific oyster hemocytes to obtain adherent cells for the construction of a C. gigas hemocyte library. Based on the genes obtained so far, this library appears to have high gene complexity and a large number of genes that have the potential to be involved in immunity. For example, two clones of an interleukin 17 homolog were isolated from this library, and the C. gigas IL17 was subsequently shown to be highly regulated in hemocytes by bacterial stimulation (Roberts et al. 2008). However, in analyzing the ESTs obtained in this study, we also realized that there are, in fact, a number of potential genes in the existing oyster ESTs that have not been characterized or reported and that also appeared in the current hemocyte library. By assembling all of the ESTs currently available for C. virginica and using the contigs obtained as a searchable database, we were also able to obtain complementary DNAs (cDNAs) for the eastern oyster homologs of some of the C. gigas ESTs described here. These could be valuable for comparative studies of pathogen infection between the two species.

Materials and Methods Animals and Hemocyte Plating Pacific oysters (6–8 in.) were purchased from Taylor Shellfish Farms (Seattle, WA, USA) and held at 10°C in seawater until use. Shells were opened, and the hemolymph (8–10 ml) was obtained directly from the heart using a syringe. The hemolymph was placed in a plastic tube on ice and an additional volume of cold, sterile-filtered (22 μm) seawater containing 100 U/ml penicillin, and 100 μg/ml streptomycin was added (2 ml seawater/5 ml hemolymph). After gentle mixing, 6–7 ml of the hemolymph/seawater solution was spread onto 60-mm culture plates coated with poly-lysine (Becton Dickinson). Hemolymph was obtained from nine oysters, and each oyster provided enough hemolymph for two plates. All plates were incubated at 12°C for 24 h. RNA Extraction and Library Construction After 24 h, the plated hemolymph/saltwater solution was decanted and replaced with 1 ml of Tri Reagent (Molecular Research Center) per plate. Total RNA was extracted from the Tri Reagent according to the manufacturer’s protocol (Chomcynski 1993; Chomcynski and Sacchi 1987), and

Mar Biotechnol

polyA+ RNA was isolated using the Poly-Atract messenger RNA (mRNA) isolation system (Promega). The mRNA obtained from the hemocytes was used to construct a cDNA library in Zap Express (Stratagene). cDNA produced for library construction was size-fractionated using sephacryl SF500, and the two largest cDNA size classes were ligated together with the Zap Express vector. After packaging and titering, the library was mass-excised to pBK-CMV phagemids and plated at low density. Individual colonies were randomly picked, and plasmid preparations were made using the RevPrep Orbit (GeneMachines). Plasmid preparations were sequenced from the 5′ end using the dideoxy chain termination method with “Big Dye Terminator” (Applied Biosystems) and the BK reverse vector primer. The reactions were precipitated and resuspended in “Hi-Di Formamide with EDTA” (Applied Biosystems) and run on an ABI Prism 3730 automated sequencer (Applied Biosystems). Sequence Data Analysis Sequence chromatogram files were trimmed for quality using phred (http://www.phrap.org/phrap.docs/phred.html), vector-screened using cross match (http://www.phrap.org/ phrap.docs/phrap.html), and analyzed locally using (1) Blastx against the National Center for Biotechnology Information (NCBI) nonredundant protein database, (2) Blastn against the NCBI nucleotide database, and (3) Blastn against the existing C. gigas ESTs at NCBI. Sequences were analyzed for redundancy using CAP3 (Huang and Madan 1999) and were also annotated locally using the Gene Ontology Database (version GO.200801). Simple sequence repeats were identified using the simple sequence identification tool (http://www.gramene.org/db/searches/ ssrtool; Temnykh et al. 2001). All ESTs for C. virginica were downloaded from NCBI to our local cluster and were assembled using CAP3. The ESTs described in the current paper (Table 4) were aligned (Blastn) against the contigs generated from these assembled ESTs to obtain possible homologs for C. virginica. Since NCBI does not allow the third-party submission of sequences that do not have direct “wet bench” data to support their annotation, it was not possible to submit these assembled C. viriginica sequences to NCBI for accession numbers. Instead, we provide these assembled sequences, their translated amino acid products, and the ESTs that went into creating them in an Online Appendix to the paper. Animals, Tissue Collection, and Bacterial Challenges Pacific oysters (C. gigas) were obtained from Taylor Shellfish Farms and kept in the University of Washington

holding facilities in 15°C seawater, until experimentation. In preparation for bacterial challenges, 20 oysters (ten control, ten challenge) were transferred to smaller tanks, both containing 3 l of 15°C seawater with air stones for circulation. The oysters were allowed to acclimate to ~20°C for 24 h prior to exposure. Challenges were conducted with two species of live bacteria: Vibrio vulnificus and Vibrio parahaemolyticus. Starter cultures of each species were grown separately in 100 ml Luria Bertani broth (LB) overnight at 37°C with shaking at 230 rpm. The following day, the starter cultures were combined and used to inoculate 1 l of LB. This large culture was grown at 37°C with shaking at 230 rpm until the optical density at 550 nm (OD550)=0.410. One OD550 unit is equivalent to 5×108 bacteria per milliliter (Gueguen et al. 2003), thus resulting in ~2.05×1011 bacteria. The culture was centrifuged at 4,000 rpm for 30 min at 4°C to pellet the bacteria. The supernatant was removed, and bacteria were resuspended in 100 ml of ~20°C seawater. This suspension was added to one tank containing ten oysters. The other tank of ten oysters received 100 ml of ~20°C seawater. After 24 h of exposure, the oysters were removed from their tanks, and gill tissue was collected from all oysters and immediately frozen on dry ice. The samples were stored at −80°C until RNA extraction. Quantitative PCR Analysis Frozen gill tissue (50 mg) was homogenized in Tri Reagent (1 ml), and total RNA was extracted according to the manufacturer’s protocol (Chomcynski 1993; Chomcynski and Sacchi 1987). Total RNA was treated with TURBO DNA-free (Ambion) according to the manufacturer’s protocol to remove any possible genomic DNA carryover. The treated RNA samples were quantified and all samples diluted to 0.122 μg/μl. Removal of genomic DNA from the treated RNAs was verified via real-time polymerase chain reaction (PCR) using primers known to amplify genomic DNA (data not shown). First-strand cDNA synthesis was performed with avian myeloblastosis virus reverse transcriptase (Promega) according to the manufacturer’s protocol, utilizing oligo dT primers. The reverse transcription reactions each contained 0.61 μg of total RNA. All real-time PCR reactions were created as master mixes, and individual reactions contained the following: 0.5 μL cDNA, 0.04 μM forward/reverse primers (Table 1), 2 μM SYTO-13 (Invitrogen), and 1× Immomix Master Mix (Bioline). Cycling and fluorescence measurements were carried out in an Opticon 2 System (Bio-Rad) with the following cycling parameters: one cycle of 95°C for 10 min, 40 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 30 s. Fluorescence readings were taken at the end

Mar Biotechnol Table 1 Primer sequences used for expression analysis of selected ESTs (Table 4) in gill tissue of bacterial challenged Pacific oysters Gene

Accession number

Primer names

Primer sequences

NF-kappa-B p100 subunit

EW779317

Focal adhesion kinase

EW777781

c-type lectin

EW778826

c-jun protein

EW778895

Astacin-like protein

EW779002

Tissue inhibitor of metalloprotease

EW777598

Preprocathepsin C

EW778914

Serine-protease inhibitor

EW778389

Cystatin B

EW778247

Prostaglandin E2 receptor, EP4 subtype

EW777722

Ectodysplasin A2 receptor

EW778669

CD45-like

EW777914

Integrin beta-PS precursor

EW778853

Tumor necrosis factor receptor-associated factor 3

EW779535

High-mobility group protein

EW778188

High-mobility group protein 1

EW778687

NFkB p100 5′ NFkB p100 3′ FAK 5′ FAK 3′ C-type lectin 5′ C-type lectin 3′ C-jun 5′ C-jun 3′ Astacin-like 5′ Astacin-like 3′ TIMP 5′ TIMP 3′ Preprocathep 5′ Preprocathep 3′ SPI 5′ SPI 3′ Cystatin B 5′ Cystatin B 3′ PGER EP4 5′ PGER EP4 3′ Ecdysplasin E2 5′ Ecdysplasin E2 3′ CD45-like 5′ CD45-like 3′ Integrin 5′ Integrin 3′ TNFRAF3 5′ TNFRAF3 3′ HMGP 5′ HMGP 3′ HMGP1 5′ HMGP1 3′

ATCTGTGCCAGTTCCAATCC TTCTTTTGCTCCATGGCTCT ATCACCAAGGCAACCTGAAC AATGGTGCTGGGAGTGTAGG TTCAGCGCAAAAATGAATTG AGCGCGTTTTCTGAAATTGT CAAGGCAGTGTGAAGATGGA CCAACACATGGGACTGTTTG ACGCCCTAGTTGGATGAATG ACTTGGTCTGGGGTTGTTTG AACATCCGGTTTTGTTTCCA GTCAGTGACGGCGAGTTCTT GCTGGAGGTTGCGAACTAAC AAGGTCCGTTCTTCACCAAA ATGGCCGATTGTTATGGTGT ACTGCAATTAGCCTGGCACT GAGATTCCCCCTCACTCCTC TGCTGAAAGCCTCCAAATCT ACCGAGAGTGCTGAGTGGTT GGCAAACTGTAAGCCAGGAG TGTTGATGTGGACCCAGTGT CCGATTCCTGACCATTCTGT ACAACAAGCCAAGGAACAGG TGATGTCTCCATGCGTCACT GACGATTTGCTCCAACCATT ACACTGGCACAAACCCTTTC CAAGCAACGAAAACAAAGCA AGGCTGGTGTTCAACCATTC CAAGAAAGCCAAACCTCAGC CTGGGAACCAATGCACTTTT TCATCAAAATGGCTGGTGAA ATGGACTGGCTTTGTTTTGG

of each cycle. Immediately after cycling, a melting curve protocol was run. Temperature was increased from 55°C to 95°C at a rate of 0.2°C/s with fluorescence readings every 0.5°C increase, followed by an incubation of 21°C for 10 min. Negative controls containing water instead of cDNA template were run for each primer set. Raw data were processed with Real-time PCR Miner (Zhao and Fernald 2005). Quantification was performed by calculating the relative mRNA concentration (R0) for each gene for each individual. Briefly, this was calculated using the following equation: R0 ¼ 1=ð1 þ EÞCt , where E is the average gene efficiency and Ct is the cycle number at threshold. The R0 for each gene was normalized to a control (elongation factor 1) R0 from each individual. Using the normalized R0, fold increase over the minimum R0 value for each gene was calculated for all individuals (n= 20). All data were analyzed using one-way analysis of variance with the SPSS 13 software (SPSS). Data with a significance value less than or equal to 0.05 was considered to be statistically different.

Results and Discussion General Table 2 summarizes the characteristics of the C. gigas hemocyte cDNA library and the pertinent aspects of the ESTs that were derived from it. A total of 2,646 clones were sequenced, and from these, 2,198 ESTs greater than or equal to 100 bp were analyzed and submitted to NCBI (EW777381–EW779578). Following assembly with CAP3, there were 275 contigs of greater than or equal to two sequences and 987 singletons resulting in a redundancy of 55%. When aligned to the existing C. gigas ESTs at NCBI, there were 554 sequences (one of four of the total) that had a blastn E score of greater than or equal to 10−3. Based on this score, we consider these sequences new ESTs for C. gigas, and this is a very conservative estimate given our cutoff. There have been several other bivalve hemocyte libraries reported in the literature on various species including the oyster (Gueguen et al. 2003; Jenny et al.

Mar Biotechnol Table 2 Characteristics of C. gigas hemocyte library and ESTs Characteristic

Value

Average library insert size Total number of ESTs sequenced Total number of ESTs ≥100 bp Phred quality score Average sequence length (all ESTs) Number of cDNA contigs Number of cDNA singletons Percent redundancy Number of sequences with no Blastx hit (≥10−3) Number of sequences with no significant blastn hit against C. gigas ESTs with a cutoff at 10−3

1,058 bp 2,646 2,198 13 (95%) 708 bp 275 987 55 876 554

2002; Quilang et al. 2007—mixed with other tissues), Manila clam (Kang et al. 2006), carpet-shell clam (Gestal et al. 2007), and mussel (Pallavicini et al. 2008). These libraries have reported redundancy rates from as low as 15.4% (Quilang et al. 2007) to highs of 72.7% (Gestal et al. 2007) and 78.5% (Pallavicini et al. 2008). Some of the studies (Jenny et al. 2002) did not report the percent redundancy, and strict comparisons of the rate of novel

gene discovery and redundancy between studies may not always be appropriate since some ESTs were generated directly from sequencing cDNA libraries (Kang et al. 2006) while others sequenced suppression subtractive hybridization libraries (Gestal et al. 2007; Pallavicini et al. 2008) that certainly will have different rates of redundancy and sequence size that would affect assembly. Further, some libraries are normalized, and this obviously reduces the redundancy as shown in the libraries reported by Quilang et al. (2007; 15.4%) and by Tanguy et al. (2008; average 7%) for various bivalve species and tissues. The redundancy rate of the current study (55%) falls in the middle compared to other hemocyte investigations, but regardless, the rate of new gene discovery was high. ESTs containing microsatellites with di-, tri-, and one tetranucleotide repeat were observed (Table 3). Several of these ESTs also had significant Blastx hits, including one EST (EW778460) that we highlight later in the paper (Table 4). Following annotation, the greatest proportion of the ESTs was in protein metabolism and synthesis and metabolism in general (Fig. 1). Included in these categories were ribosomal proteins that, not surprisingly, made up a

Table 3 ESTs with microsatellites including pertinent characteristics of the repeat region EST accession number

Repeat sequence

Number of repeats

Start bp

Stop bp

Length of EST

EW778058

aac

6

410

427

671

EW778818 EW778624 EW778956 EW779136 EW777687 EW778246 EW779536 EW778460

aag aag ag ag at ca caa caa

11 11 18 14 9 9 19 6

705 690 141 190 109 95 402 319

737 722 176 217 126 112 458 336

904 886 910 873 759 788 813 787

EW777448 EW777476 EW778377 EW778359 EW779138

ct ct ct ga gga

9 17 24 25 6

86 580 453 102 96

103 613 500 151 113

830 804 680 588 915

EW778453 EW778928

ggc ggc

9 9

386 582

412 608

897 835

EW778400 EW778607 EW778589 EW777557 EW779289

ggc ggc tac tc tgga

9 9 6 13 6

339 380 701 348 725

365 406 718 373 748

823 806 894 862 797

a

Existing C. gigas ESTs at NCBI with identical sequences

Existing EST at NCBIa

CU684921 CU684921 AM855122

Blastx hit [Species]

Identity score

Cathepsin Z [Sus scrofa]

130/172 (75%)

AM855218

No hit No hit No hit No hit No hit No hit No hit Mnk [Aplysia californica]

AM858458

No hit No hit No hit No hit Nucleosome assembly protein [Danio rerio] No hit RNA polymerase I [Gallus gallus] No hit No hit No hit No hit No hit

BQ426523

90/121 (74%)

148/237 (62%) 58/163 (35%)

EW77774

EW777902 EW778914

EW778927

EW779434 EW778307 EW778009 EW778389 EW778952 EW778247

Thimet oligopeptidase 1

Blastula protease 10 precursor

Prepro-cathepsin C

Cathepsin Z

Cathepsin-L-like cysteine peptidase

ADAM metalloproteinase Matrix metalloproteinase Serine protease inhibitor

Bone morphogenetic protein 1

Cystatin B like Cytokines/lytic proteins Interleukin 17 isoform D. Macrophage expressed gene EW779217 EW778608

1,402

EW777605

896

1,402

1,365

1,340

1,081

229

1,347

EW779002 EW777598

EW777946 EW777744

EW778004 EW778680

840 894

877

856

803 739 823

760

911

856

864

811

791

915 807

722 784

851 813

2 1

1

2

1 1 1

1

1

2

1

1

1

7 3

2 2

1 1 Y. lipolytica Zebrafish

Zebrafish Human

56/173 (32%) 135/243 (55%)

49/98 (50%)

82/266 (30%)

52/131 (39%) 44/173 (25%) 73/208 (35%)

143/257 (55%)

195/273 (71%)

155/287 (54%)

95/231 (41%)

143/232 (61%)

33/41 (80%)

XP_799208

Q7YT27

Q2VU37 Q9GPJ2

Q6C0Y0 NP_998664

Q6YBS2 O15162

Accession number of similar protein

Rainbow trout Abalone

Zebrafish

X. tropicalis

A. aegypti Sea urchin Scallop

Mealworm

X. tropicalis

Rainbow trout

GO:0008234 GO:0004197

GO:0008234 GO:0004197

GO:0008237 GO:0008233 GO:0008237 GO:0004197

GO:0008233 GO:0004222 GO:0008191

GO:0004197

GO:0008237 GO:0008191

GO:0003785 GO:0017121 GO:0030168 GO:0003779 GO:0005515

GO terms

Q70I20 ABP96718

Q7ZUH6

Q28C16

GO:0005125 Unknown

GO:0005509 GO:0008237 GO:0004866

Q17E69 GO:0004222 NP_001028823 GO:0004222 Q32TF4 GO:0004867

Q7YXL4

Q5EAM1

Q64HY0

Common urchin P42674

Sea urchin

Lancelet

147/281 (52%) Pearl oyster 115/115 (100%) Pacific oyster

52/133 (39%) 215/253 (84%)

110/210 (52%) 120/204 (58%)

Partial cDNA C. virginica Size Number Blastx identities Species most accession contiga (bp) in library similar to number

Cofilin (actin-depolymerizing factor 1) ARP2 (actin-related protein 2) Proteases/antiproteases Astacin-like protein Tissue inhibitor of metalloproteinase (TIMP) Cathepsin

Cell structure and motility Cyclase-associated protein-1 Phospholipid scramblase 1

Putative name/function

Cytokine activity

Metallopeptidase activity Metalloendopeptidase inhibitor activity Cysteine-type endopeptidase activity Peptidase activity Metalloendopeptidase activity Metalloendopeptidase inhibitor activity Metallopeptidase activity Peptidase activity Metallopeptidase activity Cysteine-type endopeptidase activity Cysteine-type peptidase activity Cysteine-type endopeptidase activity Cysteine-type peptidase activity Cysteine-type endopeptidase activity Metalloendopeptidase activity Metalloendopeptidase activity Serine endopeptidase inhibitor activity Calcium ion binding Metallopeptidase activity Endopeptidase inhibitor activity

Actin monomer binding Phospholipids scrambling Platelet activation Actin binding Protein binding

GO description

Table 4 Selected genes from the C. gigas hemocyte cDNA library including accession numbers, size, and the most similar Blastx comparison to the Gene Ontology Database

Mar Biotechnol

843

EW778669

Ectodysplasin A2 receptor

Integrin beta-PS precursor EW778853 (position-specific antigen beta chain) Syntenin-1 (Syndecan-binding protein 1) EW779127

754

841

EW777685 EW778826 EW778094 EW778576 EW778214

EW779472

Lectins/immunoglobulins Galectin 4-like protein C-type lectin 1 Ficolin 3 Lachesin 1 Lachesin 2

Transcription/translation/cell cycle Inhibitor of growth protein 3

cAMP-responsive element binding EW777507 protein 2 cAMP responsive element binding EW777815 protein 3-like 2 Erythroid differentiation-related factor 1 EW777674 Myocyte enhancer factor 2 EW777688

1 1 1

750 796

1

3

2 2 1 1 1

1

1 1

1

2

1

1

1

1

1

1

573

765 737 779 815 771

816

EW778003

Epidermal growth factor-like receptor

809 626

EW779535 EW778409

804

TNF receptor-associated factor 3 TNF receptor-associated protein 1

1,385

774

EW778555

Similar to tachykinin receptor

1,409

905

EW778447

907

846

EW777983

Scavenger receptor class F member 2 precursor Putative neuropeptide receptor

909

876

EW777914

EW777722

79/215 (36%) 53/60 (88%)

89/155 (57%)

42/71 (59%)

103/183 (56%)

90/144 (62%) 24/66 (36%) 66/186 (35%) 79/260 (30%) 38/131 (29%)

157/217 (72%)

122/238 (51%) 134/210 (63%)

132/239 (55%)

48/137 (35%)

35/97 (36%)

51/210 (24%)

29/89 (32%)

29/99 (29%)

70/198 (35%)

63/166 (37%)

GO:0001584 GO:0004930 GO:0004983 GO:0001584 GO:0004930 GO:0005031

GO:0016787 GO:0005044

GO:0004725

GO:0007188

GO:0007186

GO terms

NP_001096003

Q16946

Q6TEM2

A3FKF6 Q8AXR7 Q95P98 Q26474 Q24372

GO:0006355 GO:0003677 GO:0003700

GO:0003677 GO:0005515 GO:0008270 GO:0003677 GO:0003700

GO:0005529 GO:0005529 GO:0005102 GO:0005515 GO:0007156 GO:0007165

GO:0004872 GO:0050839 Q9JI92 GO:0005137 GO:0008093 A2TK68 GO:0004872 NP_001006175 GO:0000166 GO:0005524 CAC35008 GO:0004714

P11584

Q5VYX9

XP_783390

Q964E5

P59222

Q6UNF4

P35408

Accession number of similar protein

P. pygmaeus Q5R9R1 Marine jellyfish Q8T363

Cow

Sea hare

Zebrafish

Abalone Eel Sea squirt Grasshopper Fly

Mosquito

Lancelet Chicken

Rat

Fly

Human

Urchin

Flatworm

Mouse

Catfish

Human

Partial cDNA C. virginica Size Number Blastx identities Species most accession contiga (bp) in library similar to number

Receptor protein tyrosine phosphatase (CD45-like)

Receptors and associated proteins Prostaglandin E2 receptor, EP4 subtype

Putative name/function

Regulation of transcription DNA binding Transcription factor activity

DNA binding Protein binding Zinc ion binding DNA binding Transcription factor activity

Sugar binding Sugar binding Receptor binding Protein binding Homophilic cell adhesion Signal transduction

Rhodopsin-like receptor activity G-protein-coupled receptor activity Neuropeptide Y receptor activity Rhodopsin-like receptor activity G-protein-coupled receptor activity Tumor necrosis factor receptor activity Receptor activity Cell adhesion molecule binding Interleukin-5 receptor binding Cytoskeletal adaptor activity Receptor activity Nucleotide binding ATP binding Receptor protein tyrosine kinase activity

G-protein-coupled receptor signaling G-protein signaling, coupled to cAMP Protein tyrosine phosphatase activity Hydrolase activity Scavenger receptor activity

GO description

Mar Biotechnol

799

EW777589

787 878

EW778460 EW778905

848 844

EW779317 EW779189

818 816

EW779259 EW779391

Nuclear factor NF-kappa-B p100 subunit Rho coiled-coil associated kinase alpha

886

EW779098

cAMP-dependent protein kinase regulatory subunit (N4 subunit of protein kinase A) G protein beta subunit. G protein alpha S subunit

872

EW779405

cAMP responsive element binding protein-like

899

834

EW778617

Dual specificity protein phosphatase 10 (mitogen-activated protein kinase phosphatase) MAP kinase-interacting serine/threonine kinase 1 14-3-3 protein gamma (protein kinase C inhibitor protein 1)

880

EW778398

806

3′,5′-cyclic nucleotide phosphodiesterase-like

525

EW778125

Rab GDP-dissociation inhibitor

1

1

1 1

1

2

1

1

1

1

1

3

1

118/279 (42%)

31/83 (37%)

265/272 (97%) 134/265 (50%)

221/260 (85%)

138/154 (89%)

142/236 (60%)

90/121 (74%)

145/288 (50%)

47/104 (45%)

186/259 (71%)

160/205 (78%)

192/211 (90%)

Zebrafish

Chicken

Pearl oyster Silkworm

A. californica

Pacific oyster

Cow

A. californica

Human

A. aegypti

A. aegypti

X. tropicalis

Fly

Pacific oyster Snail X. laevis

783

92/116 (79%) 96/169 (56% 93/161 (57%)

EW778538

1 1 1

Mps One Binder kinase activator-like Signal transduction proteins RAB18, member RAS oncogene family

783 940 816

EW778188 EW778687 EW778483

High-mobility group protein High-mobility group protein 1 Septin 11

1,309

Partial cDNA C. virginica Size Number Blastx identities Species most accession contiga (bp) in library similar to number

Putative name/function

Table 4 (continued)

GO:0043565 GO:0003700 GO:0046983 GO:0000166 GO:0008603

GO:0003779 GO:0008426 GO:0005159

GO:0017017 GO:0004674

GO:0004725

GO:0003824 GO:0004114

Signal transducer activity Signal transducer activity GTP binding Transcription factor activity Protein binding Nucleotide binding Protein serine/threonine kinase activity

ATP binding GTP binding Transcription factor binding Rab GDP-dissociation inhibitor activity Catalytic activity Cyclic AMP phosphodiesterase activity Protein tyrosine phosphatase activity MAP kinase phosphatase activity Protein serine/threonine kinase activity Actin binding Protein kinase C inhibitor activity Insulin-like growth factor receptor binding Sequence-specific DNA binding Transcription factor activity Protein dimerization activity Nucleotide binding cAMP-dependent pK regulator

Sequence-specific DNA binding DNA binding DNA binding Nucleotide binding GTP binding Kinase regulator activity

GO:0043565 GO:0003677 GO:0003677 GO:0000166 GO:0005525 GO:0019207 GO:0005524 GO:0005525 GO:0008134 GO:0005093

GO description

GO terms

Q5GIS3 GO:0004871 NP_001093292 GO:0004871 GO:0005525 P98150 GO:0003700 GO:0005515 Q90Y37 GO:0000166 GO:0004674

P31319

Q5Y1E2

P68252

Q27SZ8

Q9Y6W6

Q16HU8

Q16KQ6

Q28D30

Q95RA8

Q70ML6 Q8ITG9 Q66J62

Accession number of similar protein

Mar Biotechnol

EW779361

EW778166

Cytochrome P450: 17A1-like

EW777901

15-hydroxyprostaglandin dehydrogenase Sterol 12-alpha-hydroxylase (CYP8B1)

EW779033

831

EW778932

Lipoxygenase 3

Cytochrome P450: 2D28-like

824

EW779143

Lipoxygnease 2

EW778340

779

EW778068

Cytochrome P450: 1A1-like

792 808

EW779247 EW777636

797

816

903

930

876

641

EW779296

875 862

EW779117 EW778895

346 1,449

886

861

EW779007

EW778477

838

EW778383

Oxidative stress induced growth inhibitor 2 Phosducin-like protein 3. Inhibitor of apoptosis protein Steroidogenic/eicosanoic/metabolic enzymes Lipoxygenase 1

Anamorsin (cytokine-induced apoptosis inhibitor 1) BNIP-2 C-Jun protein

Apoptosis Seven in absentia

530 899 762

EW777968 EW777781 EW778129

797

1

2

1

2

2

1

2

1

1 1

1

1 1

1

2

2

1 1 1

1

82/242 (33%)

243/249 (97%)

73/276 (26%)

66/220 (30%)

96/248 (38%)

93/318 (29%)

98/299 (32%)

96/262 (36%)

107/192 (55%) 85/246 (34%)

90/146 (61%)

133/259 (51%) 86/246 (34%)

80/200 (40%)

214/228 (93%)

156/212 (73%)

130/176 (73%) 73/128 (57%) 131/217 (60%)

171/191 (89%)

Catfish

Pacific oyster

X. tropicalis

Mouse

Chicken

Rat

G. fruticosa

Human

Cow Xenopus

Human

Mouse Fugu

Human

Eastern oyster

Human

X. laevis Mosquito Chicken

Aphid

EW779284

Rho family small GTP-binding protein cdc42. Focal adhesion kinase 1 Focal adhesion kinase Growth factor receptor bound protein 2 Mitogen-activated protein kinase-activated protein kinase 2

504

Partial cDNA C. virginica Size Number Blastx identities Species most accession contiga (bp) in library similar to number

Putative name/function

GO:0005515 GO:0008270 GO:0006915 GO:0006916 GO:0006915 GO:0043565 GO:0003700

GO:0000166 GO:0004674

GO:0004713 GO:0004713 GO:0007242

GO:0000166

GO terms

O73853

ABO38814

Q5FVX6

O88962

XP_420526

P12527

Q2N410

O15296

GO:0016491

GO:0004497 GO:0016491 GO:0020037 GO:0004497 GO:0016491 GO:0004497 GO:0005506 GO:0016491 GO:0004497 GO:0004508

GO:0016165 GO:0016491 GO:0016165 GO:0016491 GO:0016165 GO:0016491 GO:0016491

Q0VCW8 GO:0005515 NP_001082290 GO:0005515

Q9Y236

Q52KR3 Q800B5

Q6FI81

ABC95994

EAW93531

AAA99456 EAT43915 ABM91436

Q6PW11

Accession number of similar protein

Monooxygenase activity Oxidoreductase activity Heme binding Monooxygenase activity Oxidoreductase activity Monooxygenase activity Iron ion binding Oxidoreductase activity Monooxygenase activity Steroid 17-alpha-monooxygenase activity Oxidoreductase activity

Lipoxygenase activity Oxidoreductase activity Lipoxygenase activity Oxidoreductase activity Lipoxygenase activity Oxidoreductase activity Oxidoreductase activity

Protein binding Protein binding

Protein binding Zinc ion binding Apoptosis Antiapoptosis Apoptosis Sequence-specific DNA binding Transcription factor activity

Nucleotide binding Protein serine/threonine kinase activity

Protein-tyrosine kinase activity Protein-tyrosine kinase activity Signaling

Nucleotide binding

GO description

Mar Biotechnol

EW778471 EW778149

EW778215

EW778115 EW779151

Oxidative stress protein Cavortin

Dual oxidase 1.

Histone 3 Lysosomal phospholipase

C. viginica homologs in Appendix 1

EW778010

Heat shock protein 70

a

EW777936

Heat shock protein 90

EW779367

Insulin-induced gene 2 protein (INSIG-2)

EW777519 EW777988

EW777481

Cytochrome P450, family 4, subfamily f, polypeptide 16

Others Heat shock protein 25 Heat shock protein 12B

EW777670

Cytochrome P450 2C20 (CYPIIC20)

EW779500

1,395

377

1,405

1,150

659 805

853

798 728

924

678

836 887

726

803

804

721

842

1 1

1

1 1

9

2

1 2

4

1

1

1

1

Zebrafish Zebrafish

Mouse

Mouse

Macaque

A. aegypti

Zebrafish

Urchin

Moon jelly Pacific oyster

Pacific oyster

136/136 (100%) Human 103/222 (46%) Human

193/282 (68%)

83/165 (50%) 158/192 (82%)

291/303 (96%)

199/199 (100%) Pacific oyster

32/83 (38%) 55/181 (30%)

119/195 (61%)

122/266 (45%)

54/122 (44%

60/230 (26%)

101/288 (35%)

Mouse

EW779105

41/84 (48%)

Cytochrome P450: family 4 peptide-like Cytochrome P450

1

EW779213

Cytochrome P450: 3A16-like

348

Partial cDNA C. virginica Size Number Blastx identities Species most accession contiga (bp) in library similar to number

Putative name/function

Table 4 (continued)

NP_002098 BAD96510

Q5XMJ0

Q5EN85 Q5QGY9

Q9XZJ2

ABS18268

Q645R1 Q0R4G9

Q91WG1

NP_077762

AAB24950

Q16Y74

Q6PH32

Q64481

Accession number of similar protein

GO:0005507 GO:0008270 GO:0004601 GO:0005506 GO:0005509 GO:0016174 GO:0003677 GO:0004622 GO:0005543

GO:0009408 GO:0002040 GO:0048514 GO:0005524 GO:0051082 GO:0000166 GO:0005524 GO:0008270 GO:0004785

GO:0004497 GO:0016491 GO:0004497 GO:00016491 GO:0004497 GO:0005506 GO:0020037 GO:0004497 GO:0005506 GO:0016491 GO:0004497 GO:0005506 GO:0016491 GO:0006629 GO:0008202 GO:0008203

GO terms

Response to heat Sprouting angiogenesis Blood vessel morphogenesis ATP binding Unfolded protein binding Nucleotide binding ATP binding Zinc ion binding Copper/zinc superoxide dismutase activity Copper ion binding Zinc ion binding Peroxidase activity Iron ion binding Calcium ion binding NAD(P)H oxidase activity DNA binding Lysophospholipase activity Binding

Monooxygenase activity Oxidoreductase activity Monooxygenase activity Oxidoreductase activity Monooxygenase activity Iron ion binding Heme binding Monooxygenase activity Iron ion binding Oxidoreductase activity Monooxygenase activity Iron ion binding Oxidoreductase activity Lipid metabolic process Steroid metabolic process Cholesterol metabolic process

GO description

Mar Biotechnol

Mar Biotechnol

large proportion of the ESTs. Actin (e.g., EW778950) was the most frequently observed structural EST followed by collagen (e.g., EW778483), tubulin (e.g., EW779030), and a calponin/transgelin-like cDNA (e.g., EW779129). ESTs involved in metabolism or biosynthesis that were frequently observed included ferritin (e.g., EW778702), NADH dehydrogenase 5 (e.g., EW779040), cytochrome b (e.g., EW778907), and elongation factor (e.g., EW777741). A total of 876 ESTs had no annotation when analyzed by Blastx against the Gene Ontology (GO) Database. These ESTs were not included in the GO analysis shown in Fig. 1. A subset of ESTs are provided in Table 4 including size, accession number, sequence similarity at the protein level, GO annotation, and where available, C. virginica homologs that are provided in the Online Appendix. The ESTs presented in Table 4 were chosen based on their possible relationship with important hemocyte functions.

moving cells that drives cell motility and chemotaxis (Jones 2000). An EST (EW777946) was also found that had sequence similarity to cofilin, an actin-binding protein that controls actin assembly and has also been reported in Manila clam hemocytes (Kang et al. 2006). Finally, an EST (EW778680) was observed that had high sequence similarity to phospholipid scrambalase. Scrambalase is a palmitoylated, lipid raft-associated endofacial plasma membrane protein that accelerates bidirectional movement of plasma membrane phospholipids during conditions of elevated calcium (Zhou et al. 1997). Scrambalase is stimulated by cytokines such as stem cell factor and granulocyte colonystimulating factor, suggesting that it functionally contributes to cytokine-regulated cell proliferation and differentiation during myelopoiesis (Zhou et al. 2002).

Cell Structure and Motility

A number of ESTs were obtained that had sequence similarities to known proteases and protease inhibitors. Proteases are specifically classified into groupings based primarily on the activity of their active site, their preferred substrate, and the pH range of their proteolytic activity. As such, four classes are observed in mammalian leukocytes including serine, metalloproteinases, cysteine, and aspartic proteinases (Owen and Campbell 1999). The ESTs observed in the C. gigas hemocyte library covered nearly all of these protease classifications. Several cathepsins were observed in the library including cathepsin C (EW778914), Z (EW778927), and L (EW779434). Cathepsin C (dipeptidyl peptidase I) is recognized as a multifunctional protease that is essential for the activation of other enzymes (Turk et al. 2001). Cathepsin L is involved in the degradation of the

Locomotion, phagocytosis, and the regulation of cell shape are crucial elements of hemocyte function in oysters (Cheng 1975; Fisher 1986). Therefore, the actin cytoskeleton and its reorganization are fundamental to the function of the hemocyte as they are to vertebrate granulocytes. Sequences were observed that had high identity to genes involved in actin cytoskeletal organization. A cDNA (EW777744) was observed that was similar to Arp3, a protein that, together with Arp2, form a complex that is involved with actin polymerization (Welch et al. 1997b). Arps are found in a diverse group of eukaryotes (Welch et al. 1997a), and the Arp2/3 complex regulates the assembly of new actin filament networks at the leading front of Fig. 1 Categorization of ESTs into cellular processes derived from Blastx comparisons to the Gene Ontology Database (version GO.200801). ESTs without annotation were not included in this analysis

Proteases and Antiproteases

Mar Biotechnol

invariant chain of the major histocompatibility class II complexes (Nakagawa et al. 1998) but is also capable of generating kinin from kininogen and, therefore, may act as a kininogenase at inflammatory sites (Desmazes et al. 2003). Cathepsin Z (also called cathepsin Y) is a cysteine endopeptidase originally isolated from rat blood, which produces bradykinin-potentiating peptide from rat plasma and thereby has a dramatic effect on the action of kinins (Nakazono et al. 2002; Sakamoto et al. 1999). In invertebrates, there have been investigations on the function of several cathepsins. However, these have been primarily related to digestion (Cristofoletti et al. 2005) or other very specific functions such as the role of cathepsin L in early development in brine shrimp (Liu and Warner 2006) and cathepsins B and D in oyster development (Donald et al. 2003). To our knowledge, there have not been reports linking cathepsins to immune functions in bivalves, though past EST investigations on oyster hemoFig. 2 Messenger RNA expression levels of selected ESTs in gill tissue of Pacific oysters challenged with bacteria. Bars represent the means of ten replicate oysters±standard error. Asterisks indicate genes for which there was a significant difference (p<0.05) between control and bacterial-challenged oysters

cytes have reported the presence of cathepsin B (Jenny et al. 2002), cathepsin Z (Jenny et al. 2002), and cathepsin L (Gueguen et al. 2003). Interestingly, one of the most highly upregulated genes in mussels exposed to metal or organic mixtures is cathepsin L (Venier et al. 2006). Besides cathepsins, ESTs for two members of the astacin metalloproteinase family were observed. This included an EST (EW779002) that was most similar to a recently cloned astacin metalloproteinase that was upregulated by lipopolysaccharide (LPS) challenge in the pearl oyster (Pinctada fucata; Xiong et al. 2006). This protease was also significantly upregulated by bacterial challenge in oysters in the current study (Fig. 2). The astacin family also includes proteases such as bone morphogenetic protein 1 (BMP-1), and an EST (EW778952) for BMP-1 was also found in the C. gigas hemocyte library. BMP-1 has a number of functions in vertebrates including the formation of the extracellular matrix, the activation of latent com-

Mar Biotechnol Fig. 2 (continued)

plexes of certain TGFβ superfamily members, and the cleavage of specific proteins (e.g., prolactin) to form angiogenic factors (Ge et al. 2007). ESTs for several metalloproteinases were also observed including a matrix metalloproteinase (EW778009) and a cDNA (EW778307) for an ADAM (“a metalloprotease and disintegrin”) metalloproteinase. The ADAM metalloproteinases are particularly intriguing since they are one of the major factors involved in the proteolytic release of extracellular domains from membrane-bound precursors such as cytokines, receptors, and growth factors (Huovila et al. 2005). ESTs for several protease inhibitors were observed, including the TIMP (EW777598). This TIMP has been extensively studied in the Pacific oyster and found to be highly and rapidly upregulated following bacterial challenge or shell damage (Montagnani et al. 2001), and it was also upregulated in the oysters challenged by bacteria in the present study (Fig. 2). In addition, an EST (EW778389) was observed for a protease inhibitor with highest sequence

identity to a novel serine protease inhibitor recently described in the bay scallop (Argopecten irradians; Zhu et al. 2006). In the bay scallop protein, the inhibitor exhibits structural domains characteristic of Kazal-type serine protease inhibitors, and the expression of the inhibitor is upregulated by bacterial challenge and injury. Finally, an EST (EW778247) for a cysteine protease inhibitor most similar to cystatin B was observed. Cystatin B has been observed previously in oyster (Jenny et al. 2002) and Manila clam (Kang et al. 2006) hemocytes, and this gene was significantly upregulated by bacterial challenge in the oysters in the present study (Fig. 2). When we aligned the ESTs for proteases and protease inhibitors against the assembled C. virginica contigs, we found homologs for thimet oligopeptidase, cathepsin Z, cathepsin L, and cystatin B (see Table 4). However, the most interesting observation was a C. virginica contig (1081—Online Appendix) that showed high identity to the C. gigas TIMP.

Mar Biotechnol

Cytokines/Lytic Proteins While there are comparative immunohistochemical and experimental data to suggest that cytokines are present in invertebrates (Raftos and Nair 2004), several large-scale genomic analyses of sequenced genomes (S. purpuratus, D. melanogaster, C. intestinalis) have generally not observed chemokines (Devries et al. 2006) or helical cytokines (Huising et al. 2006). The exception is the presence of tumor necrosis factor (TNF) homologs (Robertson et al. 2006) and a number of potential interleukin 17 (IL17) homologs (Hibino et al. 2006). In the C. gigas hemocyte library, we found two ESTs (EW779217; EW779442) that aligned to vertebrate IL17. In mammals, six forms of IL17s, labeled A–F, have been described (Moseley et al. 2003). The C. gigas IL17 was most similar to the IL17D form and was found to be upregulated in hemocytes rapidly following exposure to bacteria (Roberts et al. 2008). An EST (EW778608) was obtained for a cDNA with high identity to the macrophage expressed gene (MEG), recently identified in several species of abalone (Mah et al. 2004; Wang et al. 2008). The proteins encoded by MEG in mammals and in abalone have sequence similarity to perforin (Spilsbury et al. 1995; Wang et al. 2008) and, therefore, may be involved in direct cell killing. The possible involvement of MEG in the immune response in invertebrates is further supported by the observation that it is upregulated by bacterial challenge in gastropods (Wang et al. 2008). Receptors and Associated Proteins TNF is a well-characterized proinflammatory cytokine in vertebrates that has been demonstrated to affect the growth, differentiation, and survival of immune and nonimmune cells (Goetz et al. 2004b). It is a member of the “TNF ligand superfamily” that includes a number of ligands in addition to TNF. These ligands interact with specific receptors, for example, TNF with TNF receptor 1 (TNFR1) and TNF receptor 2. TNFR1 binds intracellularly with TNF receptorassociated protein 1 (TRAP1; Song et al. 1995), and an EST (EW778409) for TRAP1 was identified in the C. gigas hemocyte library. Gene models for TNF and TNF receptors have been identified in sequenced genomes of invertebrates (Robertson et al. 2006). Besides TNFR1 and 2, a large number of other receptors have been characterized for the TNF ligand superfamily members including, for example, the ectodysplasin receptor (Ware 2003) for which an EST (EW778669) was observed in the present library and was significantly upregulated in oyster gills by bacterial stimulation (Fig. 2). TNF ligand receptors contain one or more TNF-associated factor (TRAF) motifs in their cytoplasmic domains that interact with TRAF proteins in producing a cellular effect (Dempsey

et al. 2003). In mammals, there are six different TRAFs (TRAF1–6), and some appear to be evolutionarily conserved across vertebrates and invertebrates. In the hemocyte ESTs, a cDNA (EW779535) was observed that was most similar to TRAF3, and this gene was significantly elevated by bacterial challenge (Fig. 2). TRAF3 is one of the evolutionaryconserved TRAFs (Dempsey et al. 2003), and interestingly, it has been demonstrated that TRAF3 is essential for the stimulation of type I interferon by all viral cellular recognition systems in mammals (Saha and Cheng 2006). Perhaps one the most interesting ESTs observed in the hemocyte library was a cDNA (EW777722) similar to the EP4 subtype prostaglandin E2 receptor. Prostaglandin E2 is both proinflammatory and anti-inflammatory in mammals, and it is believed that the anti-inflammatory effects of PGE2 are mediated by the EP4 receptor subtype (Minami et al. 2008; Takayama et al. 2006). In mammalian macrophages, LPS upregulates the EP2 receptor subtype but downregulates the EP4 PGE2 receptor (Ikegami et al. 2001). The C. gigas EP4 receptor mRNA was very strongly upregulated in oyster gills by bacterial stimulation (Fig. 2). The library contained an EST (EW777983) with similarity to scavenger receptors and the Drosophila draper, a gene believed to be involved in the phagocytosis of apoptotic cells in hemocytes (Manaka et al. 2004). An EST (EW777914) with identity to the vertebrate CD45 gene was observed. CD45 is expressed on all hematopoietic cells in vertebrates and is a large protein of the “receptortype protein tyrosine phosphatase” family. While CD45 has been observed in jawed and jawless vertebrates (Uinuk-Ool et al. 2002), to our knowledge, this would be the first occurrence in an invertebrate. Lectins/Immunoglobulins Several ESTs were observed that are similar to lectins. Lectins are proteins that bind specific sugar moieties, and in immune systems, they frequently bind carbohydrate moieties on pathogens. For example, a lectin was recently reported that was responsible for recognizing the parasite, P. marinus, by the Eastern oyster hemocyte (Tasumi and Vasta 2007). A cDNA (EW777685) for galectin 4 was observed in the C. gigas hemocyte library. This EST was most similar to an abalone galectin but also was very similar to recently described galectins from the freshwater snail, Biophalaria glabrata (Yoshino et al. 2008), and the argasid tick, Ornithodoros moubata (Huang et al. 2007). Both of those are tandem repeat galectins. The C. gigas galectin 4 EST did not have similarity to the galectin described by Tasumi and Vasta (2007); however, another EST (EW779109) from the library did align at the amino acid level to the C. virginica galectin and could be the C. gigas homolog.

Mar Biotechnol

A cDNA (EW778094) was also observed for a ficolin that most closely resembled the ficolin characterized from the ascidian, Halocynthia roretzi (Kenjo et al. 2001). Ficolins are lectin proteins that contain a collagen-like domain and a fibrinogen-like domain and have been implicated in pathogen recognition for phagocytosis (Matsushita et al. 1996). An EST (EW778826) most similar to a galactose-binding C-type lectin in the eel (Mistry et al. 2001) was also observed. Besides lectins, two different lachesin-like cDNAs (EW778576, EW778214) were observed in the library. Lachesins are interesting molecules since they contain immunoglobulin-like domains. The lachesin ESTs described here contained two conserved immunoglobulin domains also found in neural cell adhesion molecules, fasciclin II, and the insect immune protein hemolin (Karlstrom et al. 1993). Transcription/Translation/Cell Cycle Several putative transcription factors and molecules involved in regulating the cell cycle were identified in the ESTs. A cDNA (EW779472) with sequence similarity to inhibitor of growth 3 (ING3) was obtained. ING3 is a member of the ING family of tumor suppressors that regulate the cell cycle, apoptosis, and DNA repair. Two ESTs (EW777507, EW777815) with homology to cyclic adenosine monophosphate (cAMP)-responsive element-binding (CREB) proteins were identified. CREB proteins bind to the cAMP response element and are involved in regulating transcription. An EST (EW777674) for a transcription factor, erythroid differentiation-related factor 1 (EDRF1), was identified in the library. This gene was reported to be involved in erythroid differentiation and the upregulation of the globin gene in mammals (Wang et al. 2002). Interestingly, respiratory proteins have recently been shown to be involved in the antimicrobial defense in humans and horseshoe crabs (Jiang et al. 2007). Jiang et al. (2007) found that respiratory proteins were activated by microbial proteases to produce ROS. Thus, a gene like EDRF1 could be involved in regulating hemocyte numbers and/or composition and, in the process, antimicrobial activity. A cDNA (EW777688) for myocyte enhancer factor (MEF2) was in the C. gigas library. MEF2 is well conserved across vertebrates and invertebrates (Shiomi et al. 2005), and while it has generally been associated with the control of early muscle development (Black and Olson 1998), it is produced by other cells as well. For example, LPS (Gram-negative bacterial LPS) increased the activation of MEF2C and c-jun in mammalian monocytes, suggesting that it may have an important roll in inflammation (Han et al. 1997). Finally, ESTs (EW778188, EW778687) with sequence similarity to high-mobility group (HMG) proteins, were

obtained from the C. gigas library. One of the HMGs was most similar to a previously submitted C. gigas HMG sequence (accession no. Q70ML6); however, the EST reported here is not the homolog since the two are only 79% identical at the nucleotide level. Proteins within this family bind the minor groove of DNA and are involved in responding to pathogens and removing damaged cells (Dumitriu et al. 2005). Signal Transduction When macrophages encounter foreign molecules, extracellular receptors are activated which initiate a highly regulated signaling process involving an array of intracellular proteins that are coordinated to transmit this information to the nucleus resulting in a specific cellular response. In phagocytosis, an assortment of signaling takes place to coordinate membrane and cytoskeleton rearrangement. Gprotein-coupled receptors are activated which initiate the phosphorylation of numerous proteins, including the Rab family and focal adhesion kinase (FAK). The Rab family of proteins plays key roles in regulating the reorganization of membrane properties via lipid rafts (Hashim et al. 2000). FAK, controlled by the Arp2/3, regulates actin assembly during phagocytosis (Serrels et al. 2007). Additionally, FAK has been shown to interact with Rho GTPases, possibly activating these molecules (Zhai et al. 2003). Not only did we find an EST for Arp2 (discussed above), we also found two ESTs (EW777968 and EW777781) with similarity to FAKs. One of these kinases was slightly elevated upon bacterial challenge (Fig. 2). We also obtained an EST (EW779284) for a Rho family small guanosine triphosphate (GTP)-binding protein, and of the Rab family of proteins, we found a cDNA (EW777589) for Rab18. Rab18 is involved in reorganizing cell membranes in Salmonella (Hashim et al. 2000). The nuclear factor-kB (NF-kB) protein complex is involved in cellular responses to stimuli such as stress, cytokines, free radicals, and bacterial or viral antigens (Gilmore 1999). These proteins are translocated from the cytoplasm to the nucleus where they act as transcription factors for a variety of genes involved in cell proliferation and inflammation (Legarda-Addison and Ting 2007). In the NF-kB family, we observed a cDNA (EW779317) of the p100 subunit homolog that was significantly upregulated upon bacterial challenge (Fig. 2). The mitogen-activated protein kinase (MAPK) signaling pathway is involved in phagocytosis and the prophenoloxidase cascade in invertebrates (Lamprou et al. 2007). In the oyster library, we identified ESTs for genes involved in the MAPK signaling pathway including MAPK-activated protein kinase 2 (EW778383), MAPK-interacting serine/ threonine kinase 1 (EW778460), and dual specificity

Mar Biotechnol

protein phosphatase 10 (EW778617), a factor that acts on p38, JNK, and ERK and appears to be involved in enhancing the innate immune response (Pulido and Van Huijsduijnen 2008). Finally, an EST (EW778398) was found with homology to 3′,5′-cyclic nucleotide phosphodiesterase, a key enzyme that degrades cAMP and, thus, regulates cAMP levels. Apoptosis Apoptosis or programmed cell death is important for the homeostatic restoration of the number of immune cells at the termination of an immune response (Droin et al. 2003). In the sequencing of the C. gigas hemocyte cDNA library, several homologs of genes involved in apoptosis were identified. ESTs (EW778477) were observed for seven in absentia (SIAH) that induces cell growth arrest. In humans, SIAH is a downstream effector of p53 which functions to suppress cell growth (Matsuzawa et al. 1998). An EST (EW779007) for cytokine-induced apoptosis inhibitor (also known as anamorsin) was also found in the library. Anamorsin inhibits programmed cell death following stimulation by cytokines such as IL3 (Shibayama et al. 2004). A Bcl-2/adenovirus E1B 19 kDa interacting protein (BNIP) domain containing cDNA (EW779117) was sequenced. BNIPs are a proapoptotic subgroup of the Bcl-2 family and have previously been found in several taxa including C. elegans (Zhang et al. 2003). Another Bcl-2 family member, BAD, interacts with the 14-3-3 proteins in the regulation of apoptosis (Fu et al. 2000). 14-3-3 proteins are highly conserved and comprise a complex family that contains seven distinct isoforms in vertebrates (Aitken et al. 1995). An EST (EW778905) for the 14-3-3 protein gamma was observed in the hemocyte library. Finally, a cDNA (EW778895) for c-jun was observed, and it was significantly upregulated by bacterial challenge (Fig. 2). C-jun is a downstream target of the JNK signaling pathway activated by mitogen-activated kinases (Weston and Davis 2002). This pathway is stimulated by cytokines and exposure to environmental stress, and JNK activation has been observed, for example, in Mytilus galloprovincialis under elevated holding temperatures (Anestis et al. 2007). A c-jun EST was also reported in hemocytes of Manila clams (Kang et al. 2006). Steroidogenic/Eicosanoic/Metabolizing Enzymes A large number of ESTs were observed in the C. gigas library that had sequence similarity to cytochrome P450 enzymes. Cytochrome P450 is a large superfamily of enzymes that catalyze many reactions involved in the metabolism of xenobiotics and the synthesis of cholesterol, steroids, and other lipids. Several P450 genes have been

previously observed in bivalve ESTs (Tanguy et al. 2004), but as previously noted, these enzymes have not received very much attention in invertebrate studies (Tanguy et al. 2008). Following sequence assembly of the ESTs from C. gigas hemocytes, there were at least nine unique cytochrome P450 gene products shown in Table 4. The nomenclature system for genes in the cytochrome P450 superfamily involves the use of “CYP” followed by a number indicating the gene family, a letter indicating the subfamily, and an additional number indicating the individual gene. From the first family, one cDNA (EW778340) was identified, as being most similar to CYP1A1. CYP1A1 is also known as aryl hydrocarbon hydroxylase and is involved in the activation of aromatic hydrocarbons. CYP1A1 is regulated in response to exposure to aromatic hydrocarbons and is therefore often used as a biomarker in aquatic organisms (Chaty et al. 2004; Mcclain et al. 2003). A second EST (EW777670) was most similar to the CYP2C subfamily. Proteins in this subfamily are primarily involved in xenobiotic and steroid metabolism. The only EST (EW779033) with significant homology to an existing C. gigas P450 cDNA also belongs in the CYP2 family. There was one EST (EW779213) that was most similar to the CYP3 family and two ESTs (EW779105; EW777481) that likely belong to family 4. Finally, another cytochrome P450 cDNA (EW778166) had high sequence similarity with both the CYP7 and CYP8 families. Interestingly, members of these families are involved in bile acid biosynthesis. While there is limited information on a relationship between bile acid and pathogens outside of nonmammalian systems, bile is a primary stressor for pathogens and has been shown to have antimicrobial activity (Begley et al. 2005). CYP17A1 is an enzyme which acts on pregnenolone and progesterone in mammalian systems to convert pregnenolone and progesterone to their 17α-hydroxylated products and subsequently to dehydroepiandrosterone and androstenedione, catalyzing both the 17α-hydroxylation and the 17,20-lyase reaction. An EST (EW779361) for this gene was observed in the library. Recently, a CYP17 homolog was discovered in the amphioxus (Mizuta and Kubokawa 2007), and investigators have identified components of a sex steroid pathway in C. gigas (Matsumoto et al. 2003, 2007). These data suggest CYP17A1 could have similar steroidogenic function across taxa including oysters. ESTs for several enzymes possibly involved in the eicosanoid synthetic pathway were observed in the library. These included three separate lipoxygenase cDNAs (EW778068, EW779143, EW778932) that did not assemble with CAP3, but all had similarity to several lipoxygenases depending on the species comparison, including arachidonic 5, 8, and 15 lipoxygenases. Lipoxygenases are enzymes that catalyze the oxygenation of

Mar Biotechnol

polyunsaturated fatty acids to corresponding hydroperoxy derivatives (Brash 1999). Depending on the particular conditions and related enzymes in a cell, lipoxygenase activity can result in the ultimate production of a diverse number and type of molecules including leukotrienes, lipoxins, hepoxilins, and hydroperoxy fatty acids (Kuhn and O’Donnell 2006). Some of these mediators are produced by mammalian leukocytes and play a role in inflammation and other immune activities (Kuhn and O’Donnell 2006). Another very interesting EST (EW777901) observed was a cDNA with high similarity to mammalian 15-hydroxyprostaglandin dehydrogenase. This enzyme is key in the inactivation of prostaglandins by oxidizing the 15-hydroxyl group to a corresponding 15keto-metabolite (Ensor and Tai 1995). The EST as sequenced contained the complete open reading frame of the enzyme (accession no. EU622636). Others A number of additional genes of interest were found that did not fit easily into the other categories. A set of heat shock proteins (Hsp), including a C. gigas homologue (EW777988) of HspA12B, as well as the C. gigas Hsp70 (EW778010) and Hsp90 (EW777936), were all found in the library. The Hsps70 and 90 are interesting because of the shear number of cellular processes in which they are involved. Most Hsp70s are constitutively expressed as they are a primary component of folding newly assembled proteins, and not surprisingly, we found a large number of Hsp70 copies in the library (Table 4). Additionally, Hsp70 is involved in refolding denatured or damaged proteins, transporting these proteins to organelles for degradation, and in protection of cellular components in response to varying types of stresses. Danio rerio Hsp12B is distantly related to other Hsp70s. It is also constitutively expressed and possesses a putative adenosine triphosphate (ATP)binding domain like other Hsp70s. However, unlike most hsp70s, HspA12B is not ubiquitously expressed throughout all cell types and is only expressed in endothelial cells (Durr et al. 2004; Hu et al. 2006; Steagall et al. 2006). It also plays a critical role in regulating angiogenesis in zebrafish during development (Hu et al. 2006). Virtually, no research has examined what effect various cellular stresses may have on the expression of HSPA12B. A thorough examination of the human hsp70 family and its evolution was unable to find homologs of human Hsp12AB in any invertebrate (Brocchieri et al. 2008). As such, the data presented here provide the first evidence for the existence of an invertebrate HspA12B homolog. Another intriguing EST (EW778149) that was found in the library was cavortin. Cavortin is interesting because it is the major protein in oyster hemolymph, yet its function(s)

remains unknown. Early research describes it as a natural hemmaglutinin (Acton et al. 1969). Further research described it as a carbonic anhydrase and also a relative of copper/zinc superoxide dismutases (Cu/Zn SOD; Gonzalez et al. 2005). However, recent research by Scotti et al. (2001) shows that cavortin cannot bind a sufficient number of copper/zinc atoms to serve as a Cu/Zn SOD. Although the actual function of cavortin in oysters is still unknown, the expression of cavortin has been shown to increase during infection and in oysters which exhibit resistance to summer mortality (Huvet et al. 2004).

Conclusions A number of genes that might be involved in the function of the oyster hemocyte based on their annotation and, in some cases, their expression following bacterial challenge were observed in the current EST analysis. While some of the genes have been reported in other hemocyte EST studies, there were many that have not. Some of the new genes (e.g., IL17) may have been expressed in the oyster hemocytes as a result of their being incubated overnight on poly-lysine plates. The physical process of plating and the adhering of the cells could act as a stimulus for transcription. We have been analyzing the genes expressed in fish macrophages using similar plating and EST approaches (Goetz et al. 2004a). There are some interesting similarities between the genes observed in macrophages and hemocytes that would support a role for some genes in innate immunity extending across vertebrates and invertebrates. For example, we found genes that are presumably involved in cytoskeleton rearrangement including Arps and cofilin in both hemocytes and macrophage cDNA libraries. We also found many of the same proteases in macrophages and hemocytes including matrix metalloproteinase, cathepsins L, C, and Z (Y), and protease inhibitors such as cystatin and the TIMP. While some of these proteases my be involved in tissue reorganization at sites of inflammation, the relationship of some of the cathepsins with the kinin–kininogen pathway (Desmazes et al. 2003) is intriguing and may be occurring in both vertebrates and invertebrates given the apparent ubiquity of the kinin–kininogen system (Torfs et al. 1999; Zhou et al. 2006). It is well known that vertebrate macrophages can produce a number of different eicosanoids (Sorrell et al. 1989), and ESTs for trout macrophages contained several important genes involved in eicosanoid synthesis (Goetz et al. 2004a). In the oyster hemocytes, we also found cDNAs for several enzymes involved in eicosanoid synthesis and prostaglandin recognition. Interestingly, we found the key enzyme, 15-hydroxyprostaglandin dehydrogenase, that is involved in the initial inactivation of prostaglandins like

Mar Biotechnol

PGE. This same conversion is accomplished by the dual activity enzyme, LTB4 12-hydroxydehydrogenase/prostaglandin15-keto-reductase, found in trout macrophages (Goetz et al. 2004a). Eicosanoid synthesis and the possible effects of these mediators on immune function in hemocytes have been explored in insect hemocytes (Gadelhak et al. 1995; Stanley 2006). However, there is relatively little information concerning the role of eicosanoids in bivalve immunity and hemocyte function. Experiments using prostaglandin endoperoxide synthase and lipoxygenase inhibitors suggest that eicosanoids are involved in the response to bacteria in Mytilus hemocytes (Canesi et al. 2002). In addition, arachidonic acid supplementation in the Pacific oyster resulted in significant effects on hemocyte numbers and cellular activity, again suggesting that an eicosanoid may be involved in hemocyte function (Delaporte et al. 2006). However, to our knowledge, the synthesis and direct effects of eicosanoids have not been investigated in bivalve hemocytes. Some of the ESTs and their expression observed here would strongly suggest the involvement of a PGE eicosanoid. Of course, there are also major differences observed between hemocytes and macrophages, particularly in the occurrence in macrophages of many cytokines/chemokines and their receptors and also the presence of specific cell membrane antigens such as the major histocompatibility complex class proteins and clusters of differentiation. It is possible that many cytokines and chemokines evolved within the vertebrate lineage and, therefore, are not present in invertebrates. Further, some of the antigens present on the trout macrophages are related to the adaptive immune system that is not present in invertebrates. Until recently, virtually no research had been done on immune cell signaling in invertebrates aside from models such as Drosophila. Recent work examined medfly hemocytes and the signaling process involved during phagocytosis (Lamprou et al. 2007). By looking at FAK activation and FAK-interacting molecules, the basic signaling pathways that are activated during phagocytosis in medfly hemocytes were found to be nearly identical to those in vertebrates (Lamprou et al. 2007). Thus, some pathways may have remained relatively unchanged from insects to mammals. The cell-signaling genes uncovered in the present EST analysis suggest that similar signal transduction pathways are present in C. gigas hemocytes. Finally, there are currently 26,820 ESTs for C. gigas and 14,560 ESTs for C. virginica. While that is not necessarily a large number relative to some vertebrate species, there are already a number of genes present in those ESTs that could be very useful in understanding the immune system in bivalves. This became clear when we aligned the C. gigas ESTs in the present study with the assembled ESTs from C. virginica. A number of the homologs were already present,

and some of these may hopefully be used to design primers for comparative studies between the species. Acknowledgments This research was supported in part by the Cooperative State Research Education and Extension Service, US Department of Agriculture, under Agreement no. 2003-38500-13505 (SR).

References Acton RT, Bennett JC, Evans EE, Schrohenloher RE (1969) Physical and chemical characterization of an oyster hemagglutinin. J Biol Chem 244:4128–4135 Adema CM, Van Deutekom-Mulder EC, Van Der Knaap WPW, Meuleman EA, Sminia T (1991) Generation of oxygen radicals in hemocytes of the snail Lymnaea stagnalis in relation to the rate of phagocytosis. Dev Comp Immunol 15:17–26 Aitken A, Jones D, Soneji Y, Howell S (1995) 14-3-3 proteins: biological function and domain structure. Biochem Soc Trans 23:605–611 Anderson RS (1999) Perkinsus marinus secretory products modulate superoxide anion production by oyster (Crassostrea virginica) haemocytes. Fish Shellfish Immunol 9:51–60 Anestis A, Lazou A, Portner HO, Michaelidis B (2007) Behavioral, metabolic, and molecular stress responses of marine bivalve Mytilus galloprovincialis during long-term acclimation at increasing ambient temperature. Am J Physiol Regul Integr Comp Physiol 293:R911–R921 Badariotti F, Lelong C, Dubos MP, Favrel P (2007) Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas. FEBS J 274: 3646–3654 Begley M, Gahan CG, Hill C (2005) The interaction between bacteria and bile. FEMS Microbiol Rev 29:625–651 Black BL, Olson EN (1998) Transcriptional control of muscle development by myocyte enhancer factor-2 (MEF2) proteins. Ann Rev Cell Dev Biol 14:167–196 Brash AR (1999) Lipoxygenases: occurrence, functions, catalysis, and acquisition of substrate. J Biol Chem 274:23679–23682 Brocchieri L, Conway De Macario E, Macario AJ (2008) hsp70 genes in the human genome: conservation and differentiation patterns predict a wide array of overlapping and specialized functions. BMC Evol Biol 8:19 Canesi L, Scarpato A, Betti M, Ciacci C, Pruzzo C, Gallo G (2002) Bacterial killing by Mytilus hemocyte monolayers as a model for investigating the signaling pathways involved in mussel immune defence. Mar Environ Res 54:547–551 Chaty S, Rodius F, Vasseur P (2004) A comparative study of the expression of CYP1A and CYP4 genes in aquatic invertebrate (freshwater mussel, Unio tumidus) and vertebrate (rainbow trout, Oncorhynchus mykiss). Aquat Toxicol 69:81–94 Cheng TC (1975) Functional morphology and biochemistry of molluscan phagocytes. Ann NY Acad Sci 266:343–379 Cheng TC (1996) Hemocytes: forms and functions. In: Kennedy VS, Newell RIE, Eble AF (eds) The eastern oyster, Crassostrea virginica. Maryland Sea Grant College, College Park, MD Cheng TC, Rodrick GE (1975) Lysosomal and other enzymes in the hemolymph of Crassostrea virginica and Mercenaria mercenaria. Comp Biochem Physiol B 52:443–447 Chomcynski P (1993) A reagent for the single-step simultaneous isolation of RNA, DNA and protein from cell and tissue samples. Biotechniques 15:532–537

Mar Biotechnol Chomcynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol extraction. Anal Biochem 162:156–159 Cristofoletti PT, Ribeiro AF, Terra WR (2005) The cathepsin L-like proteinases from the midgut of Tenebrio molitor larvae: sequence, properties, immunocytochemical localization and function. Insect Biochem Mol Biol 35:883–901 Delaporte M, Soudant P, Moal J, Giudicelli E, Lamber C, Seguineau C, Samain JF (2006) Impact of 20:4n-6 supplementation on the fatty acid composition and hemocyte parameters of the Pacific oyster Crassostreas gigas. Lipids 41:567–576 Dempsey PW, Doyle SE, He JQ, Cheng G (2003) The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev 14:193–209 Desmazes C, Galineau L, Gauthier F, Bromme D, Lalmanach G (2003) Kininogen-derived peptides for investigating the putative vasoactive properties of human cathepsins K and L. Eur J Biochem 270:171–178 Devries ME, Kelvin AA, Xu L, Ran L, Robinson J, Kelvin DJ (2006) Defining the origins and evolution of the chemokine/chemokine receptor system. J Immunol 176:401–415 Donald KM, Day AJ, Smerdon GR, Cross LJ, Hawkins AJS (2003) Quantification of gene transcription and enzyme activity for functionally important proteolytic enzymes during early development in the Pacific oyster Crassostrea gigas. Comp Biochem Physiol Part B Biochem Mol Biol 136:383–392 Droin NM, Pinkoski MJ, Dejardin E, Green DR (2003) Egr family members regulate nonlymphoid expression of Fas ligand, TRAIL, and tumor necrosis factor during immune responses. Mol Cell Biol 23:7638–7647 Dumitriu IE, Baruah P, Manfredi AA, Bianchi ME, Rovere-Querini P (2005) HMGB1: guiding immunity from within. Trends Immunol 26:381–387 Durr E, Yu J, Krasinska KM, Carver LA, Yates III JR, Testa JE, Oh P, Schnitzer JE (2004) Direct proteomic mapping of the lung microvascular endothelial cell surface in vivo and in cell culture. Nat Biotechnol 22:985–992 Ensor CM, Tai HH (1995) 15-Hydroxyprostaglandin dehydrogenase. J Lipid Mediators Cell Signal 12:313–319 Fisher WS (1986) Structure and functions of oyster hemocytes. In: Brehelin M (ed) Immunity in invertebrates. Springer, Berlin Ford SE, Tripp MR (1996) Disease and defense mechanisms. In: Kennedy VS, Newell RIE, Eble AF (eds) The eastern oyster, Crassostrea virginica. Maryland Sea Grant College, College Park, MD Fu H, Subramanian RR, Masters SC (2000) 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol 40:617– 647 Gadelhak GG, Pedibhotla VK, Stanley-Samuelson DW (1995) Eicosanoid biosynthesis by hemocytes from the tobacco hornworm, Manduca sexta. Insect Biochem and Mol Biol 25: 743–749 Ge G, Fernandez CA, Moses MA, Greenspan DS (2007) Bone morphogenetic protein 1 processes prolactin to a 17-kDa antiangiogenic factor. Proc Natl Acad Sci U S A 104:10010– 10015 Gestal C, Costa M, Figueras A, Novoa B (2007) Analysis of differentially expressed genes in response to bacterial stimulation in hemocytes of the carpet-shell clam Ruditapes decussatus: identification of new antimicrobial peptides. Gene 406:134–143 Gilmore TD (1999) The Rel/NF-kappaB signal transduction pathway: introduction. Oncogene 18:6842–6844 Goetz FW, Iliev DB, Mccauley LA, Liarte CQ, Tort LB, Planas JV, Mackenzie S (2004a) Analysis of genes isolated from lipopolysaccharide-stimulated rainbow trout (Oncorhynchus mykiss) macrophages. Mol Immunol 41:1199–1210

Goetz FW, Planas JV, Mackenzie S (2004b) Tumor necrosis factors. Dev Comp Immunol 28:487–497 Gonzalez M, Romestand B, Fievet J, Huvet A, Lebart MC, Gueguen Y, Bachère E (2005) Evidence in oyster of a plasma extracellular superoxide dismutase which binds LPS. Biochem Biophys Res Commun 338:1089–1097 Gueguen Y, Cadoret J-P, Flament D, Barreau-Roumiguiere C, Girardot A-L, Garnier J, Hoareau A, Bachere E, Escoubas J-M (2003) Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteria-challenged oyster, Crassostrea gigas. Gene 303:139–145 Han J, Jiang Y, Li Z, Kravchenko VV, Ulevitch RJ (1997) Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature 386:296–299 Hashim S, Mukherjee K, Raje M, Basu SK, Mukhopadhyay A (2000) Live salmonella modulate expression of rab proteins to persist in a specialized compartment and escape transport to lysosomes. J Biol Chem 275:16281–16288 Hibino T, Loza-Coll M, Messier C, Majeske AJ, Cohen AH, Terwilliger DP, Buckley KM, Brockton V, Nair SV, Berney K, Fugmann SD, Anderson MK, Pancer Z, Cameron RA, Smith LC, Rast JP (2006) The immune gene repertoire encoded in the purple sea urchin genome. Dev Biol 300:349–365 Hu G, Tang J, Zhang B, Lin Y, Hanai J-I, Galloway J, Bedell V, Bahary N, Han Z, Ramchandran R, Thisse B, Thisse C, Zon LI, Sukhatme VP (2006) A novel endothelial-specific heat shock protein HspA12B is required in both zebrafish development and endothelial functions in vitro. J Cell Sci 119:4117–4126 Huang X, Madan A (1999) CAP3: a DNA sequence assembly program. Genome Res 9:868–877 Huang X, Tsuji N, Miyoshi T, Nakamura-Tsuruta S, Hirabayashi J, Fujisaki K (2007) Molecular characterization and oligosaccharidebinding properties of a galectin from the argasid tick Ornithodoros moubata. Glycobiology 17:313–323 Huising MO, Kruiswijk CP, Flik G (2006) Phylogeny and evolution of class-I helical cytokines. J Endocrinol 189:1–25 Huovila AP, Turner AJ, Pelto-Huikko M, Karkkainen I, Ortiz RM (2005) Shedding light on ADAM metalloproteinases. Trends Biochem Sci 30:413–422 Huvet A, Herpin A, Dégremont L, Labreuche Y, Samain JF, Cunningham C (2004) The identification of genes from the oyster Crassostrea gigas that are differentially expressed in progeny exhibiting opposed susceptibility to summer mortality. Gene 343:211–220 Ikegami R, Sugimoto Y, Segi E, Katsuyama M, Karahashi H, Amano F, Maruyama T, Yamane H, Tsuchiya S, Ichikawa A (2001) The expression of prostaglandin E receptors EP2 and EP4 and their different regulation by lipopolysaccharide in C3H/HeN peritoneal macrophages. J Immunol 166:4689–4696 Iliev DB, Liarte CQ, MacKenzie S, Goetz FW (2005) Activation of rainbow trout (Oncorhynchus mykiss) mononuclear phagocytes by different pathogen associated molecular pattern (PAMP) bearing agents. Mol Immunol 42:1215–1223 Iliev DB, Goetz GW, MacKenzie S, Planas JV, Goetz FW (2006) Pathogen-associated gene expression profiles in rainbow trout macrophages. Comp Biochem Physiol D-Genomics & Proteomics 1:416-422 Jenny MJ, Ringwood AH, Lacy ER, Lewitus AJ, Kempton JW, Gross PS, Warr GW, Chapman RW (2002) Potential indicators of stress response identified by expressed sequence tag analysis of hemocytes and embryos from the American oyster, Crassostrea virginica. Mar Biotechnol 4:81–93 Jiang N, Tan NS, Ho B, Ding JL (2007) Respiratory protein-generated reactive oxygen species as an antimicrobial strategy. Nat Immunol 8(10):1114–1122 Jones GE (2000) Cellular signaling in macrophage migration and chemotaxis. J Leukoc Biol 68:593–602

Mar Biotechnol Kang YS, Kim YM, Park KI, Kim Cho S, Choi KS, Cho M (2006) Analysis of EST and lectin expressions in hemocytes of Manila clams (Ruditapes philippinarum) (Bivalvia: Mollusca) infected with Perkinsus olseni. Dev Comp Immunol 30:1119–1131 Karlstrom RO, Wilder LP, Bastiani MJ (1993) Lachesin: an immunoglobulin superfamily protein whose expression correlates with neurogenesis in grasshopper embryos. Development 118: 509–522 Kenjo A, Takahashi M, Matsushita M, Endo Y, Nakata M, Mizuochi T, Fujita T (2001) Cloning and characterization of novel ficolins from the solitary ascidian, Halocynthia roretzi. J Biol Chem 276: 19959–19965 Kuhn H, O’Donnell VB (2006) Inflammation and immune regulation by 12/15-lipoxygenases. Prog Lipid Res 45:334–356 Lamprou I, Mamali I, Dallas K, Fertakis V, Lampropoulou M, Marmaras VJ (2007) Distinct signalling pathways promote phagocytosis of bacteria, latex beads and lipopolysaccharide in medfly haemocytes. Immunology 121:314–327 Legarda-Addison D, Ting AT (2007) Negative regulation of TCR signaling by NF-{kappa}B2/p100. J Immunol 178:7767–7778 Lelong C, Badariotti F, Le Quere H, Rodet F, Dubos MP, Favrel P (2007) Cg-TGF-beta, a TGF-beta/activin homologue in the Pacific Oyster Crassostrea gigas, is involved in immunity against Gram-negative microbial infection. Dev Comp Immunol 31:30– 38 Liu L, Warner AH (2006) Further characterization of the cathepsin Lassociated protein and its gene in two species of the brine shrimp, Artemia. Comp Biochem Physiol Part A Mol Integr Physiol 145:458–467 Mackenzie S, Planas JV, Goetz FW (2003) LPS-stimulated expression of a tumor necrosis factor-alpha mRNA in primary trout monocytes and in vitro differentiated macrophages. Dev Comp Immunol 27:393–400 Mah SA, Moy GW, Swanson WJ, Vacquier VD (2004) A perforin-like protein from a marine mollusk. Biochem Biophys Res Commun 316:468–475 Manaka J, Kuraishi T, Shiratsuchi A, Nakai Y, Higashida H, Henson P, Nakanishi Y (2004) Draper-mediated and phosphatidylserineindependent phagocytosis of apoptotic cells by Drosophila hemocytes/macrophages. J Biol Chem 279:48466–48476 Matsumoto T, Nakamura AM, Mori K, Kayano T (2003) Molecular characterization of a cDNA encoding putative vitellogenin from the Pacific oyster Crassostrea gigas. Zoolog Sci 20:37–42 Matsumoto T, Nakamura AM, Mori K, Akiyama I, Hirose H, Takahashi Y (2007) Oyster estrogen receptor: cDNA cloning and immunolocalization. Gen Comp Endocrinol 151(2):195–201 Matsushita M, Endo Y, Taira S, Sato Y, Fujita T, Ichikawa N, Nakata M, Mizuochi T (1996) A novel human serum lectin with collagen- and fibrinogen-like domains that functions as an opsonin. J Biol Chem 271:2448–2454 Matsuzawa S, Takayama S, Froesch BA, Zapata JM, Reed JC (1998) p53-inducible human homologue of Drosophila seven in absentia (Siah) inhibits cell growth: suppression by BAG-1. EMBO J 17:2736–2747 Mcclain JS, Oris JT, Burton GAJ, Lattier D (2003) Laboratory and field validation of multiple molecular biomarkers of contaminant exposure in rainbow trout (Oncorhynchus mykiss). Environ Toxicol Chem 22:361–370 Minami M, Shimizu K, Okamoto Y, Folco E, Ilasaca ML, Feinberg MW, Aikawa M, Libby P (2008) Prostaglandin E Receptor Type 4-associated protein interacts directly with NF-[kappa]B1 and attenuates macrophage activation. J Biol Chem 283:9692–9703 Mistry AC, Honda S, Hirose S (2001) Structure, properties and enhanced expression of galactose-binding C-type lectins in mucous cells of gills from freshwater Japanese eels (Anguilla japonica). Biochem J 360:107–115

Mizuta T, Kubokawa K (2007) Presence of sex steroids and cytochrome P450 genes in Amphioxus. Endocrinology 148:3554–3565 Montagnani C, Le Roux F, Berthe F, Escoubas J-M (2001) Cg-TIMP, an inducible tissue inhibitor of metalloproteinase from the Pacific oyster Crassostrea gigas with a potential role in wound healing and defense mechanisms. FEBS Lett 500:64–70 Moseley TA, Haudenschild DR, Rose L, Reddi AH (2003) Interleukin17 family and IL-17 receptors. Cytokine Growth Factor Rev 14:155–174 Nakagawa T, Roth W, Wong P, Nelson A, Farr A, Deussing J, Villadangos JA, Ploegh H, Peters C, Rudensky AY (1998) Cathepsin L: critical role in Ii degradation and CD4 T cell selection in the thymus. Science 280:450–453 Nakazono E, Kamata Y, Yamafuji K (2002) Determination of the mRNA sequence of cathepsin Y, a cysteine endopeptidase from rat spleen, 1 and confirmation of its ubiquitous expression. Biol Chem 383:1971–1975 Owen CA, Campbell EJ (1999) The cell biology of leukocytemediated proteolysis. J Leukoc Biol 65:137–150 Pallavicini A, Costa Mdel M, Gestal C, Dreos R, Figueras A, Venier P, Novoa B (2008) High sequence variability of myticin transcripts in hemocytes of immune-stimulated mussels suggests ancient host-pathogen interactions. Dev Comp Immunol 32:213–226 Pulido R, Van Huijsduijnen RH (2008) Protein tyrosine phosphatases: dual-specificity phosphatases in health and disease. FEBS J 275:848–866 Quilang J, Wang S, Li P, Abernathy J, Peatman E, Wang Y, Wang L, Shi Y, Wallace R, Guo X, Liu Z (2007) Generation and analysis of ESTs from the eastern oyster, Crassostrea virginica Gmelin and identification of microsatellite and SNP markers. BMC Genomics 8:157 Raftos D, Nair S (2004) Tunicate cytokine-like molecules and their involvement in host defense responses. Prog Mol Subcell Biol 34:165–182 Roberts S, Gueguen Y, De Lorgeril J, Goetz F (2008) Rapid accumulation of an interleukin 17 homolog transcript in Crassostrea gigas hemocytes following bacterial exposure. Dev Comp Immunol 32:1099–104 Robertson AJ, Croce J, Carbonneau S, Voronina E, Miranda E, Mcclay DR, Coffman JA (2006) The genomic underpinnings of apoptosis in Strongylocentrotus purpuratus. Dev Biol 300:321– 334 Saavedra C, Bachere E (2006) Bivalve genomics. Aquaculture 256:1– 14 Saha SK, Cheng G (2006) TRAF3: a new regulator of type I interferons. Cell Cycles 5:804–807 Sakamoto E, Sakao Y, Taniguchi Y, Yamafuju K (1999) Cathepsin Y (a novel thiol enzyme) produces kinin potentiating peptide from the component protein of rat plasma. Immunopharmacology 45:207–214 Scotti PD, Dearing SC, Greenwood DR, Newcomb RD (2001) Pernin: a novel, self-aggregating haemolymph protein from the New Zealand green-lipped mussel, Perna canaliculus (Bivalvia: Mytilidae). Comp Biochem Physiol Part B: Biochem and Mol Biol 128:767–779 Serrels B, Serrels A, Brunton VG, Holt M, Mclean GW, Gray CH, Jones GE, Frame MC (2007) Focal adhesion kinase controls actin assembly via a FERM-mediated interaction with the Arp2/3 complex. Nat Cell Biol 9:1046–1056 Shibayama H, Takai E, Matsumura I, Kouno M, Morii E, Kitamura Y, Takeda J, Kanakura Y (2004) Identification of a cytokineinduced antiapoptotic molecule anamorsin essential for definitive hematopoiesis. J Exp Med 199:581–592 Shiomi K, Fujiwara Y, Atsumi T, Kajiura Z, Nakagaki M, Tanaka Y, Mizoguchi A, Yaginuma T, Yamashita O (2005) Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression

Mar Biotechnol of the prothoracicotropic hormone gene in the silkworm, Bombyx mori. FEBS J 272:3853–3862 Song HY, Dunbar JD, Zhang YX, Guo D, Donner DB (1995) Identification of a protein with homology to hsp90 that binds the type 1 tumor necrosis factor receptor. J Biol Chem 270:3574–3581 Sorrell TC, Rochester CP, Breen FN, Muller M (1989) Eicosanoids produced during interactions between Pseudomonas aeruginosa and alveolar macrophages are specie-dependent. Immunol Cell Biol 67:169–176 Spilsbury K, O’Mara MA, Wu WM, Rowe PB, Symonds G, Takayama Y (1995) Isolation of a novel macrophage-specific gene by differential cDNA analysis. Blood 85:1620–1629 Stanley D (2006) Prostaglandins and other eicosanoids in insects: biological significance. Annu Rev Entomol 51:25–44 Steagall RJ, Rusinol AE, Truong QA, Han Z (2006) HSPA12B Is Predominantly Expressed in Endothelial Cells and Required for Angiogenesis. Arterioscler Thromb Vasc Biol 26:2012–2018 Takayama K, Sukhova GK, Chin MT, Libby P (2006) A novel prostaglandin E receptor 4-associated protein participates in antiinflammatory signaling. Circ Res 98:499–504 Tanguy A, Guo X, Ford SE (2004) Discovery of genes expressed in response to Perkinsus marinus challenge in Eastern (Crassostrea virginica) and Pacific (C. gigas) oysters. Gene 338:121–131 Tanguy A, Bierne N, Saavedra C, Pina B, Bachere E, Kube M, Bazin E, Bonhomme F, Boudry P, Boulo V, Boutet I, Cancela L, Dossat C, Favrel P, Huvet A, Jarque S, Jollivet D, Klages S, Lapegue S, Leite R, Moal J, Moraga D, Reinhardt R, Samain JF, Zouros E, Canario A (2008) Increasing genomic information in bivalves through new EST collections in four species: development of new genetic markers for environmental studies and genome evolution. Gene 408:27–36 Tasumi S, Vasta GR (2007) A galectin of unique domain organization from hemocytes of the Easter oyster (Crassostrea virginica) is a receptor for the protistan parasite Perkinsus marinus. J Immunol 179:3086–3089 Temnykh S, Declerck G, Lukashova A, Lipovich L, Cartinhour S, Mccouch S (2001) Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res 11:1441–1452 Torfs P, Nieto J, Veelaert D, Boon D, Van De Water G, Waelkens E, Derua R, Calderon J, De Loof A, Schoofs L (1999) The kinin peptide family in invertebrates. Ann NY Acad Sci 897:361–373 Turk D, Janjiƒá V, Stern I, Podobnik M, Lamba D, Dahl SW, Lauritzen C, Pedersen J, Turk V, Turk B (2001) Structure of human dipeptidyl peptidase I (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases. The EMBO journal 20:6570–6582 Uinuk-Ool T, Mayer WE, Sato A, Dongak R, Cooper MD, Klein J (2002) Lamprey lymphocyte-like cells express homologs of genes involved in immunologically relevant activities of mammalian lymphocytes. Proc Natl Acad Sci USA 99:14356–14361 Venier P, De Pitt C, Pallavicini A, Marsano F, Varotto L, Romualdi C, Dondero F, Viarengo A, Lanfranchi G (2006) Development of mussel mRNA profiling: can gene expression trends reveal

coastal water pollution? Mutat Res Fundam Mol Mech Mutagen 602:121–134 Wang D, Li Y, Shen B (2002) A novel erythroid differentiation related gene EDRF1 upregulating globin gene expression in HEL cells. Chin Med J (Engl) 115:1701–1705 Wang G-D, Zhang K-F, Zhang Z-P, Zou Z-H, Jia X-W, Wang S-H, Lin P, Wang Y-L (2008) Molecular cloning and responsive expression of macrophage expressed gene from small abalone Haliotis diversicolor supertexta. Fish Shellfish Immunol 24:346–359 Ware CF (2003) The TNF superfamily. Cytokine Growth Factor Rev 14:181–184 Welch MD, Depace AH, Verma S, Iwamatsu A, Mitchison TJ (1997a) The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly. J Cell Biol 138:375–384 Welch MD, Iwamatsu A, Mitchison TJ (1997b) Actin polymerization is induced by Arp 2/3 protein complex at the surface of Listeria monocytogenes. Nature 385:265–269 Weston CR, Davis RJ (2002) The JNK signal transduction pathway. Curr Opin Genet Dev 12:14–21 Xiong X, Chen L, Li Y, Xie L, Zhang R (2006) Pf-ALMP, a novel astacin-like metalloproteinase with cysteine arrays, is abundant in hemocytes of pearl oyster Pinctada fucata. Biochim Biophys Acta N Gene Struct Expr 1759:526–534 Yoshino TP, Cheng TC (1976) Experimentally induced elevation of aminopeptidase activity in hemolymph cells of the American oyster, Crassostrea virginica. J Invertebr Pathol 27:367–370 Yoshino TP, Dinguirard N, Kunert J, Hokke CH (2008) Molecular and functional characterization of a tandem-repeat galectin from the freshwater snail Biomphalaria glabrata, intermediate host of the human blood fluke Schistosoma mansoni. Gene 411:46–58 Zhai J, Lin H, Nie Z, Wu J, Canete-Soler R, Schlaepfer WW, Schlaepfer DD (2003) Direct interaction of focal adhesion kinase with p190RhoGEF. J Biol Chem 278:24865–24873 Zhang HM, Cheung P, Yanagawa B, Mcmanus BM, Yang DC (2003) BNips: a group of pro-apoptotic proteins in the Bcl-2 family. Apoptosis 8:229–236 Zhao S, Fernald RD (2005) Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 12: 1045–1062 Zhou Q, Zhao J, Stout JG, Luhm RA, Wiedmer T, Sims PJ (1997) Molecular cloning of human plasma membrane phospholipid scramblase. a protein mediating transbilayer movement of plasma membrane phospholipids. J Biol Chem 272:18240– 18244 Zhou Q, Zhao J, Wiedmer T, Sims PJ (2002) Normal hemostasis but defective hematopoietic response to growth factors in mice deficient in phospholipid scramblase 1. Blood 99:4030–4038 Zhou Z, Yang H, Xu X, Wang X, Lai R (2006) The first report of kininogen from invertebrates. Biochem Biophys Res Commun 347: 1099–1102 Zhu L, Song L, Chang Y, Xu W, Wu L (2006) Molecular cloning, characterization and expression of a novel serine proteinase inhibitor gene in bay scallops (Argopecten irradians, Lamarck 1819). Fish Shellfish Immunol 20:320–331