Zhou Chromosome And Chromatin 2

Chromosome Chromatin Telomeres 周金秋 [email protected] Istitute of Biochemistry and Cell Biology Shanghai Institutes for Biological Sciences Chinese Academy of Sciences Fall, 2005

I. Chromosome and Chromatin II. Centromere III. Telomeres

• Telomeres and Telomerase • Telomeres and Aging • Telomeres and Cancer

Telomeres • Telomeres are special functional complexes at the end of eukaryotic chromosomes. • Telomeres are distinctive structures, composed of repetitive DNA sequences and associated proteins, that cap the ends of linear chromosomes. • Telomeres are essential for maintaining the integrity and stability of eukaryotic genomes.

Telomere Function • Distinguish intact telomeres from broken chromosomes • Facilitate the replication of the very end of the chromosome • Transcriptionally repress the genes near telomeres

Concept of Telomere

Hermann Muller failed to recover terminally deleted chromosomes Muller, H.J. (1938), The remaking of chromosomes. The Collecting Net 13: 181-195

Barbara McClintock

provided early evidance for the crutial role that telomeres play in chromosomome stability

McClintock, B. (1939), The behavior in successive nuclear divisions of a chromosome broken at meiosis. PNAS 25: 405-416 McClintock, B. (1941), The stability of broken ends of chromosomes in Zea mays. Genetics 26: 234-282

"Have been working like hell on an exciting over-all problem in genetics with wonderful results. It gets me up early and puts me to bed late!"

Ciliates – the richest source of telomeres

Up to 10 000 000 telomeres must be generated during macronuclear development

Telomere - Simple Repeated Sequence Blackburn, EH and Gall, JG. (1978) J Mol Biol 120:33

Tetrahymena - T2G4/C4A2 Oxytricha - T4G4/C4A4

Klobutcher et al, (1981) PNAS, 78:3015-3019

Telomere structure Centromere

Subtelomeric region

Telomeric repeats

...TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG3’ ...AATCCCAATCCCAATCCC5’

Human

TTAGGG

2 – 20 kb

150 nt

Plants

TTTAGGG

0.5 – 150 kb

30 nt

S. Cerevisiae

T(G)1-3

350 bp

16 nt

Oxytricha nova

TTTTGGGG

36 nt

16 nt

S. cerevisiae telomeres nucleosomes

telosome

protective cap

report gene

Rap 1

Tel 1

Cdc 13

Rif 1/2

Ku

Stn 1

Sir complex

Ten 1

Telomere structure in mammals TRF2

TRF1 TTTAGG

?

3’

Pot1

Homodimerization

Myb

TRF1

Homodimerization TRF2

Myb

Telomere structure in mammals TRF 1

Rap 1

Pot 1

TTTAGG

?

3’

TRF 2

T-loop

Ku D-loop MRX

Visualization of T-loops in mammals

Griffith et al., Cell, 1999

The End Replication Problem 5’

3’ 5’

3’

Leading

Lagging

5’

3’

3’

5’ Lagging

Leading

5’

3’ Leading Lagging

3’

Lagging Leading 5’

The End Replication Problem

Olovnikov, AM. (1996) Telomeres, telomerase, and aging: origin of the theory. Exp Gerontol 31:443

Watson, JD. Origin of concatameric T4 DNA (1972) Nature New Biol 239:197

Hypothesis of Telomere Elongation • Homologous recombination？ – De novo telomere addition in the development of Tetrahymena macronucleus – yeast telomere sequence (TG1-3) was added in the YAC with Tetrahymena telomere sequence (T2G4)

• Enzyme？

Telomerase Activity

Greider and Blackburn (1985), Cell, 43:405-413

Discovery of Telomerase • 1985: Telomerase activity of Tetrahymena • 1989: RNA subunit of Tetrahymena telomerase • 1994: RNA subunit of S. cerevisiae • 1995: Telomerase activity of S. cerevisiae • 1996: Catalytic subunits of Tetrahymena and S. cerevisiae telomerase • 1997: Catalytic subunits of human and S. pombe telomerase, and 1st Telomerase knock mice

Telomerase Dyskerin Anchor site Catalytic site --TTAGGGTTAGGGTTAGGGTTAG

hTR hTERT

hTERT = human telomerase reverse transcriptase hTR = human telomerase template RNA

Telomerase in S. cerevisiae

Est1

Tlc1

Est3

Est2

Heloenzyme

Core enzyme Mutation of EST1, EST2, EST3 or Tlc1 showed progressive telomere shortening.

The End Replication Problem

Is Solved by Telomerase 5’

3’ Leading 5’

Lagging 3’

5’

3’

3’ Leading

Lagging 5’

3’

5’ 3’

5’

Telomere elongation by Telomerase

Telomerase RNA TERT

UCCCAAUC GTTAGGGTTAG C Telomere

Telomere elongation by Telomerase

Telomerase RNA TERT

UCCCAAUC GTTAGGGTTAGGGTTAG C AACCC Telomere

Telomere Replication

Regulation of telomerase at chromosome termini in yeast S-phase

Est1

report gene

telomerease

Cdc13 Polα

Sir2/3/4 complex

Ku

Telomere Position Effect

GFP-LacI

Interphase positioning of telomeres can be achieved through two partially redundant mechainnisms. One requires the heterodimeric yKu complex. The second requires Silent information regulators, correlates with transcriptional repression, and is specific to S phase. Hediger et al, (2002) Current Biology 12:2076

• Telomeres and Telomerase • Telomeres and Aging • Telomeres and Cancer

Aging - Senescence Aging the progressive loss of function accompanied by decreasing fertility and increase mortality with advancing age

Senescence (senex, meaning "old man" or "old age.“) the state or process of aging.

Replicative Senescence (Cellular senescence) a state that cells arrest after they undergo a limited number of cell division

Lifespan a time period cells (or organism) can live

Senescent Phenotypes • Irreversible arrest of cell division (G1 DNA content, cannot resume proliferation by mitogens). • Resistant to apoptotic death (for example, human fibroblasts and T lymphocytes, but not endothelial cells). • Selected changes in morphology and metabolism, and derangements in differentiated functions (cellular enlargement, increased lysosome biogenesis, and expression of a β-galactosidase).

Characteristics and Inducers of the Senescent Phenotypes Irreversible growth arrest Others

Apoptosis resistance

Altered differentiated function

Telomere shorting Tumor suppressor activity DNA damage Oncogenic/ Mitogenic Stimuli Chromatin remodeling

Itahana1K, Dimri G and Campisi J (2001) Regulation of cellular senescence by p53. Eur. J. Biochem. 268 :2784-2791

History of cellular aging study Alexis Carrel: chicken heart fibroblast cells in culture were established, and grown for 34 years - vertebrate cells can divide indefinitely in culture; age is “an attribute of the multicellular body as a whole” Witkowski J (1985) Trends Biochem Sci 10:258-260

Hayflick limit Hayflick:

fibroblast cultures derived from human skin divide 40 to 50 times, and stop to undergo “senescence”; cells from older people undergo fewer division then cells from younger people. Carrel’s immortal chicken cell cultures were not reproducible.

Questions:

Does the limited capacity of cells to divide relate to human aging? What tells cells to stop dividing? Hayflick, L. and Morrhead, PS (1961) Exp Cell Res 25:585

What is the connection of telomeres with aging ? In culture normal human somatic cells exhibit a restricted lifespan and enter senescence after a set number of division (~50) In human somatic cells telomeres shorten by 5-20 repeats with every cell division Most somatic cells do not have detectable telomerase activity Telomere length shortens with the age of a cell and eventually cell dies when telomere becomes too short

Telomeres Shorten With Increased Age Sperm Placenta Fetal brain Fetal kidney Colon mucosa (30-65 yrs) Colon mucosa (65-88 yrs) Blood (20-39 yrs) Blood (40-59 yrs) Blood (60-79 yrs)

0

Tissue Source

4

8

12

16

20 (kb)

Telomere Length (kb) Hastie et al, Nature, 346: 866

Length of telomeres varies among different cell types

Telomere Length

Germline/ES cells (telomeres maintained)

Pluripotent Stem cells (intermediate telomere loss) Normal cells (greatest telomere loss) Growth Arrest

Cell Divisions - Replicative Age

Aging Theory of Telomere Loss In the absence of telomerase, telomeres shorten with each cell division. When telomeres reach a critically short length, normal cells irreversibly arrest proliferation and acquire a characteristic enlarged morphology and a variety of altered functions. This response has been termed replicative or cellular senescence.

Aging Theory of Telomeres Loss Keith et al. (2002) Expert Rev Mol Med

The telomere length is thought to be the “mitotic clock” that is read to establish the Hayflick limit when cells cease to divide. (Mitotic clock: utilize cell divisions as the unit of time, rather than chronological or metabolic age) Harley et al. (1990) Nature 345:458

Short Telomeres are Associated with pre-mature aging

• •

Werner’s Syndrome: Wrn, 3’ to 5’ DNA helicase/nuclease deficiency telomeres are lost at a greater rate Hutchinson-Gilford Progeria: a point mutation in lamin A, a component of the inner nuclear membrane. Some tissues have short telomeres

Telomere length

Image credit: William and Wilkens Publishing Inc.

Hutchinson-Gilford Progeria

Birth

Middle AgeOld Age

Telomere shortening causes cellular senescence ? Cellular senescence causes telomere shortening ?

Telomerase activity in stable retinal pigment epithelial (RPE-hTRT-) clones.

Andrea G. Bodnar et al (1998) Extension of Life-Span by Introduction of Telomerase into Normal Human Cells. SCIENCE VOL. 279:349

Telomere length in stable RPE and BJ (foreskin fibroblast) clones.

Bodnar et al (1998). SCIENCE 279:349

Effect of telomerase expression on cell life-span

Bodnar et al (1998). SCIENCE 279:349

hTERT expression is sufficient to immortalize normal human cells 160

hTERT +

Population Doublings

140 120 100 80

hTERT -

60 40 0

50

100

150

Days

200

250

300

Telomerase can promote proliferation of resting stem cells

Sarin et al. (2005) Nature 436:1048

Telomerase Deficient Yeast Senesces

Zhou et al, (2000) Science 289:771

Telomere dysfunction leads to defects in plant growth

Riha et al., Science (2001)

G3 Ter knock-out mice are premature ageing

Rudolph et al. (1999) Cell 96:701

Dyskeratosis Congenita • Die between the ages of 16 and 50 (premature greying, early dental loss, bone marrow failure, liver cirrhosis, pulmonary disease and skin cancer) • X chromosome: Dyskerin (nucleolus, pseudouridylation of specific residues of RNA. • Levels of telomerase RNA are low, • Telomeres are shorter than normal in white blood cells and fibroblast cells.

Question: what is Dyskerin’s function in stabilizing telomerase RNA and promoting telomerase activity?

Tom Vulliamy et al (2001) The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature Vol. 413:432

Telomeres are shorter in the cells from DC patient

Summary of telomeres and aging Telomerase activity

Telomere homeostasis

Repress chromosomal instability Extension of life span

• Telomeres and Telomerase • Telomeres and Aging • Telomeres and Cancer

Telomeres and Cancer • Tumors are caused by mutations, which activate oncogenes and switch off tumor suppressor genes. • With few remarkable exceptions, not many human tumor cells would make it into a full-blown, clinically relevant tumors without overcoming telomeredependent replicative senescence. • In

humans, telomerase activity detected in many types of cancer cells, and not detectable in most somatic cell lineage. (Kim et al, 1994 Science)

Telomere hypothesis of immortalization Activation of telomerase activity in cancer cells stabilizes telomere length

Germline cells: telomerase positive

TRFt length (kb)

~15 Stem cells

Normal somatic cells: telomerase negative M1 5-7 M2 2-4

Transforming event Precrisis cells: no telomerase Immortal tumor cells

telomerase activity

M1 M2 Hayflick limit Crisis

Cell Division

Telomerase activity is required for tumorigenic conversion of human cells The ectopic expression of the telomerase catalytic subunit (hTERT) in combination with two oncogenes (the simian virus 40 large-T oncoprotein and an oncogenic allele of H-ras) results in direct tumorigenic conversion of normal human epithelial and fibroblast cells. Hahn et al, (1999) Nature 400:464

Alternative Lengthening of Telomeres (ALT) • Telomerase activity detected 85% of cancer cells. (Kim et al, 1994 Science)

• Some telomerase-negative tumors (10-15% of cancer) maintain stable length of their telomeres.

Question How these cells maintain their telomeres? No telomerase, no cancer?

Alternative Lengthening of Telomeres (ALT) est2∆

EST2+

Tlc1 Est2 tlc1 RAD52 tlc1 rad52 Telomerase core enzyme

Teng and Zakian MCB (1999)

Lingner et al. Science (1997)

Alternative Lengthening of Telomeres (ALT) XhoI X’

Y’

TG1-3

1.3 kb

Tlc1 Est2

Telomerase core enzyme

•Enzyme？ •Homologous recombination？

Teng and Zakian (1999) :8083-93.

Alternative Lengthening of Telomeres (ALT) 3’ 5’

Homologous recombination: a DNA strand from one telomere anneals with the complementary strand of another telomere, thereby priming synthesis of new telomeric DNA using the complementary strand as a copy template

Require Rad52

Strand invasion

Elongation

Resolution of DNA strands and repair synthesis

Net telomere elongation

3’ 5’

Alternative Lengthening of Telomeres (ALT)

tlc1 RAD52 tlc1 rad52

Teng and Zakian (1999) MCB :8083-93.

WT (A and B)

NIIDA, et al (2000) Telomere Maintenance in Telomerase-Deficient Mouse Embryonic Stem Cells: Characterization of an Amplified Telomeric DNA. MCB Vol 20:4115-4127

DKO741

NIIDA, et al (2000) Telomere Maintenance in Telomerase-Deficient Mouse Embryonic Stem Cells: Characterization of an Amplified Telomeric DNA. MCB Vol 20:4115-4127

DKO301

NIIDA, et al (2000) Telomere Maintenance in Telomerase-Deficient Mouse Embryonic Stem Cells: Characterization of an Amplified Telomeric DNA. MCB Vol 20:4115-4127

Depletion of TRF2 disrupts capping of chromosome ends

+ Telomere Binding

Cells overexpressing TRF2∆B∆M Smogorzewska et al., Curr.Biol. (2002)

Genome instabilities triggered by chromosome end-to-end fusions 45S rDNA BAC F11L15

Nondisjunction

Chromosome loss

Chromosome rupture

Nonreciprocal translocation

Siroky et al., Chromosoma (2003)

Cellular consequences of telomere dysfunction

Kim et al (2002) Telomeres, aging and cancer: In search of a happy ending. Oncogene 21, 503 ± 511

Telomerase serves as a target for cancer therapy T-loop D-loop

Intact telomere

(TTAGGG)n

Telomerase inhibitor

? 3’

Stasis (premature senescence) Telomere-based senescence Apoptosis

DNA Damage Signal

Aging

Death

Increased genomic instability (engagement of ALT or telomerase revertants)

Telomerase Inhibitor Approaches

•

Catalytic (hTERT) component – Reverse transcriptase inhibitors – hTERT promoter/gene therapy – Dominant-negative or shRNA hTERT gene therapy – Small molecule inhibitors

•

Template (hTERC) functional RNA component – Hammerhead ribozymes – hTR template – Oligonucleotides – telomerase template antagonist

Selective killing of telomerase expressing cancer cells with replication competent viruses hTERT-promoter

Adenovirus

Normal cell Telomerase Viral agent hTERT adenovirus

Viral replication blocked

Cell destruction Viral release Virus spread

Cancer cell Telomerase +

Viral replication

Ly si Un s Bu tr e ff e ate r d Ve cto DN r con - hT tr ER ol T Un tr e Ve ated cto rc on DN tro - hT l E Un RT tr e ate d Ve cto r DN cont ro - hT l ER T

Inhibition of telomerase with DN-hTERT (D869A) leads to cancer cell death H1299 RCC23 DU145

DN-hTERT

DN-hTERT Cre excised

Telomerase RNA (hTR) template as a target for inhibition GRN163: 3 ‘NH2-AACAGATTGGGAT-OH 5' hTER: 5‘…UUGUCUAACCCUAAC…3'

hTR/(RNA)

• Stable to nucleases • Forms extremely stable heteroduplex with RNA (Tm13mer > 70oC)

hTERT Catalytic protein

• Competitive with telomere binding • Binding is base pair-dependent • When bound, prevents telomeric substrate binding

Telomerase Activity and Telomere Length in Cells Treated with GRN163

ro l co nt

ro l

GRN163 co nt

co nt 1. rol 25 12 µM 5 12 nM .5 nM

GRN163

kb 19 7.7 6.2

•

4.3

2.7

• •

1.9

•

3.5

1.5

1 m 3x/wk over 2 months HME50 cells

Potential as a universal oncology target High tumor specificity Synergy expected with cytotoxic drugs Systemic delivery possible

Summary

Telomere Shortening

Telomere

(telomerase inactivation) Promote genomic instability

Limits lifespan

Telomere Stabilization (telomerase activation)

Chromosome stability

Tumor Suppression

Immortality

Tumor Promotion

Adapted from Masutomi and Hahn (2003), Cancer Letter 194:163-172

How do organisms deal with the end replication problem? Parvovoruses: Priming via DNA

Adenoviruses: Protein priming

Drosophila: Retrotransposition

3’

Pol

pTP Ser-C-OH 3’ G HeT-A

Some plants and insects: Homologous recombination? Majority of eukaryots: Telomerase

TART

Telomere evolution Vertebrates TTAGGG C.Elegans TTAGGC S. cerevisiae Ustilago TTAGGG S.Pombe TTACAGG(G)0-4 Pneumocystis TTAGGG Neurospora TTAGGG C.albicans ACGGATGTCTAACTTCTTGGTGT Human K.lactis ACGGATTTGATTAGGTATGTGGTGT S.cerevisiae T(G)1-3 Arabidopsis TTTAGGG Asparagales TTAGGG Tetrahymena TTGGGG T-loops: Slime molds TAGGG mammals, protozoa, plants Kinetoplastida TTAGGG Giardia TAGGG Li et al., Cell (2000)

Telomere – telomerase evolution

Nakamura et al., Science (1997

Humanization of yeast telomeres Yeast tlc1 strain (T(G)1-3 telomere)

report gene

Cdc13 Sir complex

Rap1

Yeast tlc1h strain (TTAGGG telomere)

report gene

Cdc13 Telomere binding factor 1 (TRF1/2 homologue) Alexander & Zakian, EMBO J. (2003)

Model for telomere evolution Retrotransponson

Circular genome

RT Linear genome with terminal repeats

Genomic RNA

AAAAA

T-loop phase

Telomerase RT

Telomerase phase

5’ 3’

3’

Template RNA

5’ Telomerase-mediated telomere maintenance

Telomere capping by T- loops and telomere-specific proteins

de Lange, Nat. Rev. Mol. Cell Biol. (2004)

Acknowledgements

Ms. Fu Xiao-Hong Ms. Li Ning Dr. Wong Jimin

Thank You