Ribosom.docx

Sebelumnya Diterbitkan Pekerjaan UC Berkeley A University of California penulis atau departemen telah membuat artikel ini tersedia secara terbuka. Berkat Senat Akademik Terbuka Kebijakan Access, banyak sekali publikasi ilmiah UC-menulis sekarang akan tersedia secara bebas di situs ini. Marilah kita tahu bagaimana akses ini penting bagi Anda. Kami ingin mendengar cerita Anda! http://escholarship.org/reader_feedback.html eScholarship menyediakan akses terbuka, layanan penerbitan ilmiah di Universitas California dan memberikan platform penelitian yang dinamis untuk sarjana di seluruh dunia.

Mengintip pada Judul: profil Ribosom mengungkapkan apa, kapan, di mana dan bagaimana protein sintesis Journal Issue: Nature Molecular Cell Biology, 16 (11) Author: Brar, GA Weissman, JS Tanggal Publikasi: 2015/10/22 Seri: UC Berkeley Sebelumnya Diterbitkan Pekerjaan Juga Tersedia: UC San Francisco Sebelumnya Diterbitkan Pekerjaan Permalink: http://escholarship.org/uc/item/78t9g779 DOI: https://doi.org/10.1038/nrm4069 Identifier lokal: 1.178.381 Abstrak: © 2015 Macmillan Penerbit Limited. Profiling semua hak reserved.Ribosome, yang melibatkan sequencing dalam fragmen mRNA ribosom dilindungi, adalah alat yang ampuh untuk memantau terjemahan global in vivo. Metode ini telah memfasilitasi penemuan regulasi ekspresi gen yang mendasari beragam dan kompleks proses biologis, aspek penting dari mekanisme sintesis protein, dan bahkan protein baru, dengan menyediakan pendekatan sistematis untuk penjelasan eksperimental dari daerah coding. Di sini, kami memperkenalkan metodologi profiling ribosom dan mendiskusikan contoh di mana pendekatan ini telah menjadi faktor kunci dalam membimbingbiologis, penemuan termasuk peran penting dalam mengidentifikasi ribuan diterjemahkan Novel rangka baca terbuka pendek dan produk terjemahan alternatif. Informasi hak cipta:-undang kecuali dinyatakan lain. Menghubungi penulis atau penerbit asli untuk setiap izin yang diperlukan. eScholarship bukan pemilik hak cipta untuk karya disimpan. Pelajari lebih lanjut di http://www.escholarship.org/help_copyright.html#reuse eScholarship menyediakan akses terbuka, layanan penerbitan ilmiah di Universitas California dan memberikan platform penelitian yang dinamis untuk sarjana di seluruh dunia.

ULASAN TECHNOLOGIESDAN TEKNIK profiling Ribosom mengungkapkan apa, kapan, di mana dan bagaimana sintesis protein Gloria A. Brar1,3,4 dan Jonathan S. Weissman2-4 Abstrak | Profil ribosom, yang melibatkan sequencing dalam fragmen mRNA ribosom dilindungi, adalah alat yang ampuh untuk memantau terjemahan global in vivo. Metode ini telah memfasilitasi penemuan regulasi ekspresi gen yang mendasari beragam dan kompleks proses biologis, aspek

penting dari mekanisme sintesis protein, dan bahkan protein baru, dengan menyediakan pendekatan sistematis untuk penjelasan eksperimental dari daerah coding. Di sini, kami memperkenalkan metodologi profiling ribosom dan mendiskusikan contoh di mana pendekatan ini telah menjadi faktor kunci dalam membimbing penemuan biologis, termasuk peran penting dalam mengidentifikasi ribuan diterjemahkan Novel rangka baca terbuka pendek dan produk terjemahan alternatif. Ribosom jejak kaki mRNA fragmen ~ 30 Translation, yang merupakan proses dimana ribosom dari posisi ribosom pada saat di mana trans- berbunyi template mRNA untuk memandu sintesis protein, adalahsebuah lationdihentikan. Mengukur kepadatandilindungi nukleotidayang dihasilkan dari langkah penting dalam ekspresi gen. Terjemahanyang bergairah fragmenpada transkrip yang diberikan menyediakan proxy untuk pengobatan nuklease dari Cally mahal dan karena itu diatur secara ketat untuk melestarikan laju sintesis protein. Selain itu, menentukan ribosom menerjemahkan. Ini adalah daerah mRNA yang dilindungi oleh ribosom sebagai mRNA diterjemahkan ke sumber daya seluler, serta untuk menghindari kesalahan yang mungkin posisi fragmen dilindungi memungkinkan untuk menghasilkan produksi protein beracun. Memang, lebar empiris mengukur identitas berbagai produk terjemahan negara penyakit, termasuk neurodegeneration, (misalnya, di mana mereka mulai dan akhir danbahkan protein berurutan. anemiaDan cacat perkembangan tertentu, terjadi ketika bingkai sedang dibaca). Hal ini telah menyebabkan penemuan banyak proses translasi dikompromikan (lihatyang dipilih Novelatau products10-19 protein alternatif. The distribu1Jurusan Molekuler dan Biologi Sel, Universitas ref 1-6).Meskipun banyak yang diketahui tentangstructionjejak kaki ribosom dapat memberikan wawasan ke dalam mendatang dan fungsi ribosom,pemahaman kita mekanismekontrol translasi (misalnya, dapat California, Berkeley, dari banyak aspek regulasi terjemahan telah digunakan untuk mengidentifikasi jeda translasi peraturan dan California 94720, USA. jauh lebih terbatas. diterjemahkan hulu rangka baca terbuka 2Howard Hughes Medical Institute, Departemen Seluler dan Molekuler Farmakologi, Universitas Upaya untuk global ekspresi gen memantau secara historis berfokus pada mengukur kadar mRNA ( misalnya, menggunakan microarrays atau RNA sequencing (RNA- California, San Francisco, seq)), meskipun kita tahu bahwa kontrol translasi adalah California 94.158, USA. 3Center untuk RNA Sistem Biologi, University of California, Berkeley, California 94720, USA. sebuah langkah penting dan diatur dalam menentukan tingkat ekspresi protein. Sampai saat ini, terjemahan pemantauan tepatnya adalah jauh lebih menantang daripada yang measur- ing tingkat mRNA. Ini telah berubah dengan 4California Institute mengembangkan- untuk

ment dari ribosom pendekatan profiling, yang pertama kali Biosciences Kuantitatif (QB3), Universitas dijelaskan pada tahun 2009 (REF. 7) California, San Francisco, California 94.158, USA. e-mail: [email protected]; [email protected] doi: 10.1038 / nrm4069 Diterbitkan online 14 Oktober 2015 SIFAT ULASAN | MOLECULAR CELL BIOLOGI VOLUME 16 | November 2015 | 651 © 2015 Macmillan Publishers Limited. Semua hak dilindungi (uORFs)). Akhirnya, adaptasi novel dengan ribosom profil pendekatan memungkinkan untuk memantau terjemahan dimediasi oleh set sub ribosom atas dasar lokasi fisik mereka di dalam sel atau mitra interaksi mereka. Di sini, kita membahas prinsip-prinsip pendekatan pengajuan ribosom pro, kekuatan dan keterbatasan, dan contoh terbaru di mana ia telah membimbing penemuan biologis. Kami fokus pada nilai profiling ribosom sebagai alat untuk menginterogasi apa yang sedang diterjemahkan, bagaimana bahasa dari ini. tion diatur dan di mana dalam sel penjabaran Ribosom profiling adalah alat berbasis deep-sequencing set spesifik protein terjadi. yang memfasilitasi pengukuran rinci terjemahan global dan di vivo7. Pada inti dari pendekatan ini adalah Apa profiling ribosom dan apa yang bisa ia mengungkapkan? pengamatan bahwa ribosom menerjemahkan sangat melindungi profiling Ribosom mengeksploitasi klasik molekul sekitar 30 nukleotida dari mRNA dariactiv- nuklease metodedari footprinting8,9 ribosom, di mana in vitro ity8,9. Sequencing fragmen ribosom dilindungi tersebut, mRNA diterjemahkan diperlakukan dengan nuklease untuk menghancurkan jejak kaki ribosom diistilahkan, sehingga memberikan catatan yang tepat daerah yang tidak dilindungi oleh ribosome7,9 tersebut.

ULASAN Hulu rangka baca terbuka seperti daun pengobatan 'jejak kaki' dari ~ 30 nukleotida, ribosom yang dapat dipetakan kembali ke mRNA asli untuk menentukan lokasi yang tepat dari ribosom menerjemahkan. Profiling ribosom meluas metode ini dengan pemetaan dan mengukur lengkap in vivo ribosom jejak kaki untuk mengukur sintesis protein baru dan untuk anno- tate daerah coding globally7,10-12 (Gambar 1,2) 652 | November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. Semua hak dilindungi profiling memiliki berbagai kegunaan, dari alat teomic pro luas untuk probe spesifik terjemahan dalam in vivo (uORFs). ORFs dalam5 pengaturan'pemimpin,dan sebagai pelengkap berharga untuk mRNA-seq. wilayah dariditandai profil Ribosommembutuhkan koleksi transkrip mRNA fisiologis. Terjemahan dari uORFs dapat mengatur terjemahan dari ORF hilir. Profiling ribosom memungkinkan sampel logis; penghambatan terjemahan untuk membekukan somes ribo- dalam tindakan terjemahan; nuklease pencernaan untuk menghasilkan fragmen ribosom dilindungi; dan isolasi untukidentifikasi empiris ribosomdan, kemudian, dari footprints21 ribosom. dari semua diterjemahkan uORFs in vivo di bawah kondisi yang menarik. Meskipun uORFs pendek, di sini kita tidak memasukkan mereka dalam.Kemajuan luar biasa dalam sequencing memungkinkan untuk mendalam sampel semua ribosom menerjemahkan. Dalammamalia

technology20

sekarang

jejak kaki Ribosomdikonversi ke sel untai-spesifik, misalnya, yang mengkodekan ~ 20.000 protein dengan

perpustakaan dan dikenakan generasi sekuensing, rata-rata mRNA coding wilayah ~ 500 kembar tiga nukleotida, dan fragmen kemudian dipetakan ke yang sesuai kelas 'ORFs pendek', yang nuklease pencernaan semua menerjemahkanribosom-mRNA. referensi genom Profil ribosom biasanya mobil-yang pada mRNA yang tidak kompleks menghasilkan 10 juta jejak kaki mungkin. Mencapai miliaran The Ried pada sampel split, dengan perpustakaan paralel con yang diperkirakan sebelumnya untuk mengkodekan protein. singa dari membaca yang sekarang mungkin dengan generasi structed untuk mengukur mRNA kelimpahan oleh mRNA-seq. sequencing memungkinkan kuantifikasi handal dari himpunan Perbandingan antara tingkat sintesis protein dan jejak kaki ubin di semua tetapi mRNA paling langka, dan kelimpahan mRNA memungkinkan untuk menentukan kit barubaru dikembangkan memfasilitasi sampel preparation21,22. efisiensi translasi untuk setiap mRNA7 (Gambar 1a, b; 2b, c) Dengan informasi dengan mudah dicapai dan kuantitatif seperti,.Sifat-sifat biofisik umum dari ribosom dan Cell jenis bunga In vivo penangkapan menerjemahkan ribosom dan mRNA, lisisnya sebuah profil Ribosom b mRNA-seq c AAAAAAAAAA aaaaaaaaa Low density jejak kaki sebelum memulai kodon dan setelah kodon stop (tinggi dalam ke luar / rasio) AAAAAAAAAA Ribosom jejak kaki Agustus Berhenti Gambar 1 | Gambaran profil ribosom. a | MRNA ribosom terikat terisolasi oleh ukuran dan diperlakukan dengan nuklease nonspesifik (biasanya RNase I atau nuklease micrococcal), menghasilkan fragmen mRNA yang dilindungi disebut 'jejak kaki'. Jejak kaki ribosom terisolasi dan dikonversi ke perpustakaan untuk sequencing mendalam. Jejak kaki ribosom biasanya menunjukkan posisi yang tepat antara awal dan kodon stop dari gen, yang memfasilitasi identifikasi global dan eksperimental dari daerah coding genom. b | Sebagai perbandingan, mRNA sequencing (mRNA-seq) menangkap fragmen acak meliputi seluruh transkrip mRNA. Informasi posisi ditentukan oleh standar mRNA-seq AAAAAAAAAA Tinggi% dari ORF ditutupi oleh ribosom jejak kaki AAAAAAAAAAA aaaaaaaaa AAAAAAAAAAA e sdaer AAAAAAAAAA mosobi R tnirptoof aaaaaaaaaaaa aaaaaaaaaaaa posisiGenomic

Mulai Berhenti pengobatanNuclease fragmentasi Acak aaaaaaaa A Kodon periodisitas AAAA AAA AAAAAAAAAA Perpustakaan generasi generasi Perpustakaan Jauh sequencing s sda Jauh sequencing AAGCTGCTTACGACCTGCATGCAG em daertn Baca pemetaan erqes Baca pemetaan osobi R irptoof 5 'pemimpin 3' UTR - ANR m Coding wilayah posisi Genomic posisi Genomic 5 'transkrip akhir 3' transkrip akhir (sering menunjukkan (sering menunjukkan transkripsi awal situs) transkripsi berhenti situs) memungkinkan tepat perkiraan dari itu penentuan dikumpulkan oleh Nature ribosom dari Ulasan transkrip profil, batasbatas, | Molekul karena Cell namun kerugian Biologi itu kurang 5'dan 3'berakhir selama metode generasi fragmen yang biasanya digunakan. c | Diterjemahkan rangka baca terbuka (ORFs) mengandung organisasi stereotip jejak kaki ribosom. Density jejak ribosom lebih ORFs dimulai tajam pada awal kodon, berakhir tajam pada kodon stop dan menunjukkan bukti kodon periodisitas. Daerah diterjemahkan benar cenderung menunjukkan cakupan jejak ribosom selama sebagian besar ORF dan tidak biasanya di daerah sebelum kodon start diduga dan setelah kodon stop diduga. UTR, diterjemahkan wilayah.

ULASAN kolam Contoh mRNA AAAAAAAAAAA aaaaaaaaaaaa AAAAAAAAAA AAAAAAAAAA aaaaaaaaa aaaaaaaaaaaa aaaaaaaaaaaa Terjemahan uORF sORF berhenti Genome Browser petak Ribosom jejak berbunyi penjelasan b Gene mRNA-seq membaca c Transkrip kelimpahan

Protein sintesis tingkat efisiensiTranslation (steady state) (sesaat) (relatif) stnuoc AN m R stnuoctnirptoofemosob i R T Gambar 2 | Data kualitatif dan kuantitatif yang disediakan oleh profil ribosom. a | Sampel kolam renang beragam mRNA, dibedakan oleh warna, ditampilkan, bersama-sama dengan perwakilan rencana genom browser yang sesuai dari ribosom profil data yang berasal dari kolam ini. Perhatikan bahwa profil ribosom memfasilitasi penentuan eksperimental daerah diterjemahkan, termasuk frame pendek terbuka membaca (sORFs), yang mungkin menjadi sumber baru diidentifikasi penting peptida seluler, dan ORFs hulu (uORFs), yang dianggap sebagian besar peraturan. Berhenti selama terjemahan elongasi dapat mengakibatkan puncak di tapak ribosom membaca dalam ORFs. b | Penjelasan gen overlay dan mRNA sequencing (mRNA-seq) data untuk contoh di bagian yang akan ditampilkan. c | Grafik menunjukkan contoh data kuantitatif yang berasal dari bagian a dan b. Perhatikan bahwa kelimpahan transkrip mungkin tidak berkorelasi erat dengan tingkat sintesis protein seketika. Pengumpulan data kuantitatif untuk kedua kelimpahan transkrip dan tingkat sintesis protein memungkinkan efisiensi terjemahan relatif disimpulkan. Ini dapat bervariasi dari beberapa kali lipat dalam organisme tertentu dalam keadaan tertentu. Efisiensi terjemahan juga dapat berubah seiring waktu untuk mRNA diberikan, mencerminkan regulasi yang dinamis di tingkat terjemahan. SIFAT ULASAN | MOLECULAR CELL BIOLOGI VOLUME 16 | November 2015 | 653 © 2015 Macmillan Publishers Limited. Semua hakdilindungi stnirptoofemosobi R ANR m ORFs ORFs UlasanORFs Nature | Molecular Cell Biology kurangnya manipulasi genetik yang diperlukan untuk ini tikus, tikus, tanaman, virus dan cells7,10-12,19,23-30 manusia. Pendekatan membuat profil ribosom yang sangat mudah beradaptasi dengan Bahkan mitokondria terjemahan dalam sel manusia memiliki selsel atau jaringan dari dasarnya setiap organisme, dengan modtelah efektif diuji oleh method31 ini, dan modifikasi est serupa. Organisme yang telah diteliti pendekatan telah diterapkan untuk kloroplas di cells32 tanaman. sejauh oleh profiling ribosom meliputi berbagai bacteBanyak dari set data telah disusun dan dibuat ria, ragi, protozoa parasit, ikan zebra, lalat, nematoda, mudah diakses untuk data mining dan comparison33. r a n s l a t i o AAAAAAAAAAA n e f

fi c i e n c y

ULASAN Apa kekuatan dari profil ribosom? sintesis dan tingkat transkrip kondisi mapan, menyediakan Meskipun perkembangan baru-baru ini, ribosom profil kesempatan untuk mengukur in vivo efisiensi terjemahan telah dengan cepat menjadi alat yang banyak digunakan untuk mengertisecara rinci (Gambar. 2c).ing beragam dan kompleks masalah biologis. Tiga fitur utama, yang diuraikan di bawah ini, telah memfasilitasi Apa keterbatasan metode? utilitas luas metode ini. Kita bahas di bawah kelemahan penting dan peringatan dari profiling ribosom yang harus dipertimbangkan ketika Sensitivitas dan ketepatan kuantifikasi. Ribosom menggunakan metode atau menafsirkan data yang berasal dari profiling menyediakan rentang dinamis yang besar untuk detecpenggunaannya. tion dan kuantifikasi terjemahan dalam sel gentar. Sensitivitas dari metode ini, yang dihasilkan dari eksperimental diperkenalkan distorsi. Kunci techni- kedalaman sampling yang mungkin dalam sequencing cal tantangan profil ribosom adalah kebutuhan untuk cepat penelitian, memfasilitasi pengukuran bahkan relatif menghambat terjemahan untuk menangkap snapshot dari ribosom dalam acara terjemahan langka, dengan kisaran deteksi sebuah kondisi fisiologis tertentu. Keandalan langkah ini umumnya hanya dibatasi oleh variabilitas penghitungan yang sangat penting untuk setiap analisis terjemahan terlihat dengan jumlah yang sangat rendah sequencing berbunyi. menjeda, sebagai tingkat yang cepat terjemahan elongasi dapat saling melengkapi metode, termasukberbasis label berdenyut hasildalam sinyal kabur atau akumulasi spektrometri massa buatan, analisis distribusi transkrip ribosom pada posisi tertentu jika penghambatan lambat. pada gradien polysome dan 35S Met berbasis metabolisme labelPenggunaan inhibitor terjemahan elongasi (seperti ling, memungkinkan pengukuran sensitifprotein baru cycloheximidesyn)dapat berharga; Namun, jelas tesis bahwa; Namun, yang sangat paralel sequencing pembacaan inhibitor tersebut dapat mengubah distribusi lokal ribo- dari semua posisi ribosom yang disediakan oleh ribosom somes pada mRNA, terutama di dekat terjemahan mulai profiling biasanya menghasilkanlebih kuantitatif dan sites7,18,21,41rinci.Meskipun ini tampaknya tidak mengganggu informasi dari saat ini dapat diakses oleh alternatif pengukuran global kepadatan ribosom pada metode.

mRNA yang digunakan untuk menentukan tingkat sintesis protein, dapat menyebabkan puncak palsu dari ribosom bindPresisi informasi posisional. Selainnya ingdi situs tertentu. Sejauh ini, flash beku telah dynamic range luas deteksi, ribosom profil pendekatan yang paling kuat di berbagai beragam menyediakanINFORMATION unik yang kaya dan tepat posisi organismedan telah memungkinkan fisiologis capture tion. Sifatsifat biofisik hampir universal ribodari distributions21 ribosom lokal dan global. Secara umum, somes seluruh spesies menghasilkan ukuran jejak karakteristik setiap langkah eksperimental - dari pemanenan sel ke nucle- yang memungkinkan prediksi kodon dalam r ibosome situs P ase pencernaan ke generasi perpustakaan - memiliki potensi (yaitu, posisi peptida pembentukan ikatan) dan menyebabkan distorsi dalam output data. Ini distor- deteksi kodon periodicity7 (FIG. 1c).Analisisribotionsharus diperhitungkan dengan hati-hati, karena sejauh beberapa posisi tapak dapat digunakan untuk mekanis yang setiap distorsi yang diberikan mungkin bermasalah akan menyelidiki aspek penerjemahan, sejauh mengidentifikasi banyak sangat bergantung pada pertanyaan yang ditangani dan contoh Novel dari frameshifting ribosom, menghentikan kodonsyste m sedang diselidiki. readthrough, menjeda ribosom, inisiasi penerjemahan di Polysome gradien kodon non-Agustus dan uORF translation7,10,12,34-37 (FIG. 2a). Kebutuhan untuk menyimpulkan tingkat sintesis protein. Sebuah peringatan untuk con- Sebuah metode untuk ribosom fraksionasi yang terikat untuk mRNA oleh kecepatan sentrifugasi ekstrak sel pada Selanjutnya, tahun setelah bertahun-genom awalnya Sider ketika menafsirkan ribosom profil data yang dijelaskan, yang tepat posisiinformasi yang diperoleh tingkatdari sintesis biasanya disimpulkan dari aver- dari ribosom profil percobaan telah memberikan usiakepadatan ribosom sepanjang mRNA yang bersangkutan. Gradiensukrosa, memungkinkan untuk kesempatan pertama untuk eksperimental menentukanditerjemahkan akurasidari ukuran ini tergantung pada premis bahwa pemisahan mRNA yang ORFs11-13,38,39 (Gambar. 1,2) semua ribosom menyelesaikan terjemahan dan bahwa rata-rata, yang berhubungan dengan satu ribosom (monosome) dari orang-orang yang diterjemahkan oleh beberapa ribosom (polysome). Tingkat perpanjangan terjemahan serupa di antara mRNA yang berbeda dalam sel. Asumsi ini dapat diuji dan sesuai untuk berbagai kondisi, tetapi ini akan sukrosa fraksinasi gradien tidak selalu menjadi kasus. Dikenal exceptions42-44 - termasuk memfasilitasi analisis kualitatif status terjemahan sel.

build-up dari ribosom di dan segera proksimal kodon start di sebagian cycloheximide tergantung situsRibosom PSitus dalam sebuahaktif menjeda terjemahanmanner7 atau diatur dan aborsi di bawah kelaparan conditions45 - dapat diperbaiki untuk menerjemahkan ribosom yang meningkat pengukuran akurasi, tapi mungkin ada kasus biasanya berhubungan dengan tRNA melekat pada rantai peptida berkembang. di mana ini dan lainnya, saat ini tidak diketahui, pengecualian menimbulkan tantangan untuk analisis data yang tepat. Kodon periodisitas Pencemaran fragmen jejak berukuran. Lain Pola tiga nukleotida hunian ribosom, mencerminkan mRNA translokasi di ribosom oleh kodon sebagai,sehingga identifikasi kelas baru coding daerah dalam organisme beragam. Pengukuran seketika. Sebuah properti yang berharga akhir dari profil ribosom adalah sifat sesaat dari informasi yang dikumpulkan, yang mencerminkan snapshot dari proses dinamis penerjemahan. Meskipun mRNA-seq dan standar spektrometri massa genom skala KASIH pengalaman- berharga dalam mengikuti ekspresi gen global, pengukuran ini banyak digunakan melaporkan tingkat mapan mRNA dan protein, masing-masing. Tion INFORMATION ini penting, tetapi mungkin tidak mencerminkan pengambilan keputusan seluler yang cepat yang menyertai tions transi- perkembangan dan tanggapan lingkungan. Profiling ribosom memungkinkan deteksi sensitif dari perubahan protein seluler masalah penting bagi ribosom profil ekspresi percobaan karena mereka occur7,12,40. Umum, kuantitatif adalah bahwa jejak kaki yang disimpulkan berdasarkan output ukuran dari profiling ribosom dan mRNA-seq lebih lanjut dan hubungan mereka dengan berkumpul (80S) ribosom. terjemahan terjadi. memungkinkan untuk perbandingan langsung dari proteinseketika, Pencemaran fragmen RNA termasuk dari 654 | November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. Semuahak dilindungi

ULASAN terstruktur non-coding RNA atau ribonucleopro- besar belum dapat diterapkan untuk sel tunggal. Keterbatasan ini kompleks Tein yang co-bermigrasi dalamgradien sukrosa hasildari langkah pemrosesan tambahan yang diperlukan dengan ribosom, dapat diproses dengan ribosom untuk mengisolasi ribosomes21, serta sebagian kecil profil perpustakaan dan memberikan pembacaan palsu trans setiap diberikan molekul mRNA yang sedang diterjemahkan di lation apapun (lihat informasi Tambahan S1 (gambar)). diberikan instan dan dengan demikian dapat diperoleh kembali sebagai jejak kaki (Gambar. 1a).Pendek atan baru-baru ini, disebut fragmen panjang organisasi Sangat mungkin bahwa jenis kemajuan teknis yang memiliki nilai kesamaan (floss) analisis, bertujuan untuk mengidentifikasi seperti sangat meningkatkan sensitivitas RNA-seq pendekatan fragmen dan menghapus mereka pasca-eksperimental (yang kecil jumlah sel juga akan berlaku di masa depan adalah, dalam silic o) 39. Analisis FLOSS didasarkan pada pengamatan ke profil ribosom, meskipun ada upaya besar seperti memiliki yang bonafide ribosom jejak kaki memiliki stereo khas belum dilakukan. distribusi ukuran tapak (lihat informasi Tambahan S1 (gambar, bagian a dan b)).distribusi yang

Wawasandisediakan oleh profiling ribosom ukuran tapak khas 80S digunakan dalam analisis floss adalah Dengan keunggulan ini dan kerugian dalam pikiran, secara empiris diukur untuk setiap percobaan, olehexamaplikasidari profiling ribosom untuk biologi- tertentu ining ukuran jejak kaki di bahwa samapercobaan pertanyaancal telah mengkonfirmasi banyak dari apa yang kita ketahui dari daerah penyandi protein yang diketahui, dan dapat digunakan untuk sekitar mekanisme terjemahan dari dekade elegan komputasi mengidentifikasi mencemari fragmen untuk struktural, biokimia dan genetik studies50. Penghapusan ribosom. Meskipun demikian, ada contoh di managenuprofilingjuga telah memungkinkan untuk memonitor bahasa dari ine 80S mRNA jejak kaki tidak sesuai dengankhas tiondengan kedalaman belum pernah terjadi sebelumnya dan presisi, memberikan pola ukuran. Dua kasus terbaru yang menyoroti menarik yang penting - dan sekaligus mengejutkan - wawasan. Biologi yang ditentukan oleh analisis alternatif penerapan metode ini untuk banyak organisme dan jejak kaki ribosom berukuran menunjukkan efek yangkarena menyatakan selulertelah memperjelas aspek-aspek fundamental untuk kedua conformations46 ribosom alternatif danalterbiologi selyang sebelumnya menantang untuk menyelidiki mRNA asli properties41 (lihat di bawah). Nuklease proteksi eksperimental, menyediakan pengukuran untuk berapa banyak tes tion bisa menjadi kontrol tambahan yang berguna untuk mengidentifikasi setiap protein disintesis, bagaimana terjemahan Ikutan berbagai ukuran tapak ribosom dalam-organ baru lated, di mana sintesis dimulai dan berhenti dan apa yang menjadi isme atau kondisi, sehingga menginformasikan desain sebuah ribodisintesis. beberapa profil percobaan untuk terbaik capture semua ribosom menerjemahkan dalam sistem tertentu. Berapa banyak? Pandangan kuantitatif sintesis protein. The Ribosomal RNA (rRNA) fragmen umumnya menghasilkan sederhana dan aplikasi luas dari profiling ribosom dari langkah nuklease-pengobatan profil ribosom adalah sebagai alat proteomik kuantitatif untuk memantau dan secara substansial dapat menurunkan jejak ribosom protein sedang disintesis, dan pada tingkat , sehingga ruang sequencing di ribosom profil experiment7, memberikan wawasan molekul yang kaya menjadi negara sel tertentu. khususnya dalam kondisi di mana terjemahan global kepadatan jejak Ribosom mencerminkan jumlah tingkat riborendah. Sedangkan mRNA-seq sering menggunakan poly (A) somes pada posisi tertentu. Dengan asumsi bahwa rata-rata pilihan sebagai metode yang efektif untuk isolasi tingkat perpanjangan terjemahan ini serupa untuk gen yang berbeda, urutan yang diinginkan, pendekatan ini tidak mungkin dengan profil ribosom menyediakan langsung, global dan quantitaribosom profiling. Pengurangan selektifribosom pengukuran tivedari tingkat sintesis protein, sehingga fragmen, bagaimanapun, adalah sangat efektif dan ini merekomendasikan informasi menangkap yang sebagian besar telah terlihat diperbaiki, terutama untuk sampel yang kecilNUM

pengukuran ekspresi gendari tingkat mRNA saja . ber dari jejak berukuran rRNA fragmen tertentu terlihat massa spektrometri bisa, pada prinsipnya, digunakan untuk measur e sebagai contaminants21. tingkat sintesis protein; Namun, ini secara teknis sulit, karena biasanya membutuhkan pelabelan metabolik dan Pemetaan ambigu membaca. Tantangan umum dalam beberapa pengukuran per sampel. Analisis analisis data sequencing adalah menentukanyang benar posisidari mRNA di gradien polysome memberikan posisi alignment untuk membaca dariberulang atau sangat informasi pelengkapberharga untuk yang daerah yang sama diperoleh, seperti keluarga gen, atau dari alternatif dengan profiling ribosom, tapi sekali lagi, metode ini adalah labo- Fragmenpanjang variantranskrip. Dalam kasus sekuensing genom atau rious dan biasanya hanya menghasilkan ukuran kualitatif dari nilai organisasi kesamaan (floss) analisis Sebuah metrik untuk menentukan probabilitas bahwa ribosom jejak kaki di atas diberikan wilayah mRNA-seq, lagi membaca atau dipasangkan-end47 pendekatan dapat sintesis protein . membantu untuk menyelesaikan ambiguitas tersebut, tetapi inheren pendek Dalam banyak kasus, kemampuan untuk mengamati ukuran protein baru syn-jejak kaki ribosom menghalangi inieksperimen tesissecara global dan kuantitatif memberikan wawasan yang mendekati. Namun, metode komputasi yang memiliki tidak jelas dari pengukuran mRNA abun- (atau set daerah) hasil dari dikembangkan untuk data mRNA-seq untuk menetapkanmultiply. tari Operon bakteri memberikan contoh nyata tentang terjemahan. Analisis ini melibatkan membandingkan distribusi ukuran jejak kaki di atas wilayah query dan lebih pemetaan membaca secara probabilistik atas dasar nilai bisa langsung mengukur tingkat protein keseluruhan membaca distributions48 dapat diterapkan untukribosom. sintesis Seperti halnya bagi banyak protein kompleks di profil data yang untuk mengurangi keterbatasan ini. bakteri, delapan subunit yang berbeda dari F o daerah coding divalidasi dan didasarkan pada konsep bahwa sifat biofisik menerjemahkan ribosom menghasilkan tanda tangan karakteristik dalam jumlah Material. Saat ini, keterbatasan utama profiling ribosom dibandingkan dengan pendekatan mRNA-seq adalah persyaratan untukyang relatif besar ukuran ribosom jejaksam-. prinsip keuangan. Berbeda dengan mRNA-seq49, ribosom profil SIFAT ULASAN | MOLECULAR CELL BIOLOGI VOLUME 16 | November 2015 | 655 © 2015 Macmillan Publishers Limited. Semua hak dilindungi -ATP syn thase dinyatakan dari mRNA polisistronik tunggal, dan dengan demikian pengukuran tingkat mRNA akan menyarankan bahwa subunit semua diekspresikan pada tingkat yang sangat mirip. Profil ribosom, bagaimanapun, menunjukkan bahwa ORFs individu yang mengkodekan subunit F o F 1

F 1 -ATP synthase

ULASAN sebuah E. coli F o F 1 -ATP operon synthase b D. rerio pengembangan zigotik BEFHAGDC Nanog (peringkat 25, TF rank 1) information12. Dalam data ini, gen yang bertanggung jawab untuk kompleks, dilestarikan dan meiosis spesifik proses rekombinasi homolog dan perakitan kompleks synaptonemal muncul sebagai satu cluster dari 46 gen. mRNA-seq membaca 10 tnirptoofemos 3)FPH 2 (ecnadn Sox19b Pou5f1 (rank (peringkat 185, 101, TF TF peringkat peringkat 3) 2) Pengamatan ini mengejutkan, karena ini cesses pro dikenal diatur secara ekstensif di pos- tingkat translasi, dan juga karena cluster termasuk obi R uba hampir setiap gen yang telah ditemukan melalui dekade jejak Ribosom membaca 21 skrining genetik dan sitologi intensif terfokus 5.000 10.000 Ibu mRNA oleh peringkat pada proses ini. cluster ini juga termasuk beberapa gen uncharacterized , dua di antaranya (GMC1 dan GMC2) yang kemudian terbukti memiliki peran dalam rekombinasi 104 E Ibu terjemahan dan formation12,53 kompleks synaptonemal. contoh terbaru lain yang mencolok dari jenis analisis ini digunakan ribosom profil untuk mengidentifikasi faktor-faktor) noi D. rerio hanya (2 hpf; embrio Nanog tahap 64-sel) Sox19b yang bertanggung jawab untuk inisiasi zigotik mengembangkanetarsis tarenegr Program mental yangdi zebrafish54 (. Gambar 3b).Inisiasi Pou5f1

zigotik transkripsi S (4 hpf; tahap lingkup) Terutama zigotik terjemahan 2 6 Stoikiometri protein di kompleks pembangunan zigotik pada vertebrata sangat bergantung ehtny epsel B C G H A pada kontrol translasi, sebagai mRNA ibu memberikan kolam mulai dari bahan untuk penerjemahan. Zigotik ucelom (F D aktivasi kemudian mengharuskan penghancuran ini mRNA nal mater- dan transfer kontrol perkembangan untuk zigot itu sendiri Untuk menentukan faktor-faktor yang medi- makan gelombang pertama transkripsi zigotik, ribosomhpf.; 0 0 4 8 10 (6 tahap perisai) .profiling Data dianalisis untuk sampel yang dikumpulkan sebelum aktivasi zigotik studi ini mengidentifikasi Nanog, Sox19b dan Pou5f1 sebagai tiga transkripsi faktor Gambar 3 | profiling Ribosom memfasilitasi penemuan proteomik kuantitatif dalam beragam yang paling banyak diterjemahkan, dari sistem kolam besar . a | sel bakteri menerjemahkan komponen dari kompleks protein multi-anggota di mRNA ibu pada tahap ini (Ga mbar 3b.) rasio yang sebanding dengan stoikiometri mereka di kompleks ini sebuah contoh penting adalah F|. o 656 November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. Semua hak dilindungi.Setelah dari satu F 1 -ATP operon. synthase, mRNA yang abundanc e is composed for each of eight gene different is thus similar, proteins but (A ribosome to H), translated profiling reveals intricate translational control. b | Zebrafish zygotic development requires the initiation of zygotic transcription 2 hours post-fertilization (hpf), although the specific transcription factors responsible for this transcription have been unclear. Ribosome profiling of embryos at 2 hpf showed that the three most highly translated transcription factors (TFs) from maternal mRNAs were Nanog, Sox19b and Pou5f1, and subsequent experiments confirmed that these three proteins drive zygotic activation. morpholino knockdown experiments showed that specifically blocking translation of these three factors resulted in a shutdown of the first wave of zygotic tran- scription and development, indicating that they are the key factors responsible for the initiation of the zygotic developmenta l programme54. Other recent studies in disparate systems — from the Drosophila melanogaster oocyte-to-embryo transi- D. rerio, Danio rerio; E. coli, Escherichia coli; mRNA-seq, mRNA sequencing. Part a is tion55 to the Trypanosome life cycle56 to the mamma- modified with permission from REF. 51, Elsevier. Part b is modified from REF. 54, Nature

lian cell cycle57 to plants under hypoxic conditions27 Publishing Group. — have used ribosome profiling to identify specific proteins that drive these complex processes. Cases in which ribosome profiling data provide markedly dif- operon are translated at a ratio of 1:1:1:1:2:3:3:10. ferent information than can be obtained by traditional Remarkably, these ratios precisely reflect the stoichiomemRNA abundance measurements for gene expression try of these components in the ATP synthase51,52 (FIG. 3a) . tend to fall into two categories: systems in which tran- This property of proportional synthesis, by which subscriptional regulation is minimal26,54,55; and dynamic units of multiprotein complexes are synthesized at rates cellular programmes11,12,27,35,57–59. The latter category that are proportional to their stoichiometry in the comincludes cellular differentiation, organismal develop- plex, turns out to be generally true for Escherichia coli ment and dynamic responses to cellular stress, which and was also observed for some (but not all) complexes are all cases in which the instantaneous and downstream in budding yeast (Saccharomyces cerevisiae). Such measgene expression measurements provided by ribosome urements of instantaneous rates of protein synthesis may profiling are particularly illuminating for understanding prove to be a general tool for exploring how proteins molecular control. assemble and function together51. Quantitative measurement of protein synthesis rates How? Insights into the mechanism of translational over multiple time points of a dynamic process can also control. The basic mechanism by which the riboso- provide information about specific gene function. For mal machinery reads codon information in mRNAs to example, hierarchical clustering of patterns of new procreate proteins is conserved, and many features of this tein synthesis for each gene over the dynamic process of process are well understood50. Nonetheless, there are meiosis in budding yeast resulted in an intricate map of aspects of translational control that are not amenable gene expression that provided highly detailed functional to recapitulation in vitro and for which results from

REVIEWS Wild-type cell dom34Δ mutant cell that mapped to 3′ UTRs in the absence of Dom34 were Ribosome footprint reads (subset of genes) ORF 3′ UTR not restricted to a single reading frame (FIGS. 1c, 4)

. This observation suggested that these footprints did not rep- resent canonical translating ribosomes but were instead likely to result from a population of ribosomes that had Stop Stop failed to be released from mRNAs following translation termination (FIG. 4) Codon periodicity Codon periodicity No codon periodicity AAAA Translating ribosomes Nature Reviews | Molecular Cell Biology NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 16 | NOVEMBER 2015 | 657 © 2015 Macmillan Publishers Limited. All rights reserved . Together, these data indicate that ribosomes are not always automatically released follow- ing stop codon recognition, and that Dom34 has a role in freeing ribosomes from truncated transcripts and 3′ UTRs41. Another important application of ribosome pro- AAGCTGCTTACG AAGCTGCTTACG TATGTATATCCAG filing has been the analysis of the mechanisms of drugs that target translation. Macrolides, for example, are a class of clinically important antibiotics that are known to bind in the nascent peptide exit channel of the ribo- some. Macrolide activity has long been thought to cause Ribosomes that fail to be released from mRNA after translation termination early translational inhibition by blocking the egress of nascent peptides from the ribosome. However, this view has been overturned by recent ribosome profiling studFigure 4 | Dom34 facilitates the release of 80S ribosomes from a subset of 3ʹ untranslated regions (UTRs). Ribosome footprints indicative of assembled 80S ribosomes are seen in a subset of 3′ UTRs in dom34Δ mutant cells. Unlike 80S ribosome footprints from open reading frames (ORFs), however, these do not show codon Translating ribosomes ies63–65, which found that macrolides function primar- ily by selectively affecting the ability of the ribosome to form peptide bonds in specific sequence contexts. A key observation was that in bacteria that were treated periodicity and represent ribosomes that have failed to properly release following with high doses of erythromycin or of telithromycin, a translation termination. next-generation macrolide, not all protein synthesis was inhibited. In fact, telithromycin inhibited the translation of fewer proteins than erythromycin, despite being a genetic approaches alone may be difficult to interpret, more effective antibiotic64. owing to complex secondary effects that result from celThe application of ribosome profiling to bacterial lular adaptation to chronic abnormal protein synthesis. cells treated with erythromycin or telithromycin also Furthermore, ribosome profiling facilitates the idenshowed that, even in cases of inhibited translation for tification of translation mechanisms that vary across a given mRNA, the ribosome did not always stop transorganisms, cellular state and individual transcripts, as lating early in the transcript, as predicted by the classical well as the study of the roles of specific translation facmodel for macrolide action. Rather, ribosome footprint tors. Several important examples of discovery in transbuild-up, which is indicative of ribosome stalling, could lation mechanism have been highlighted in previous be seen at various regions in the subset of mRNAs that reviews22,60,61. Here, we focus on just two recent studies were inhibited. The precise positional information that in which ribosome profiling has illuminated important was obtained from these experiments made it possible aspects of translation.

to determine that these points of translation interruption Dom34 (a homologue of eukaryotic release factor 1) were dependent on specific positively charged sequences has been shown to help to dissociate stalled ribosomes ([R/K]X[R/K]) that were present in the peptidyl trans- in vitro, but how and where it acted in vivo was unclear. fer centre of the ribosome. Macrolide-mediated inhi- Recent work explored the function of this protein bition of translation thus was not occurring primarily through ribosome profiling of wild-type and dom34Δ through obstruction of the peptide exit channel of the budding yeast cells. The authors reasoned that if Dom34 ribosome but instead was a result of ineffective peptide was either dissociating ribosomes on truncated tranbond formation for certain amino acid sequences. This scripts or causing multiple ribosomes to stack up owing effect could be recapitulated precisely in vitro for some to stalling, then the relevant footprints might be smaller mRNAs, but poorly for others, suggesting that additional or larger, respectively, in the absence of Dom34 (REF. 41) cellular factors might contribute to macrolide action63. (FIG. 4) . Indeed, in the case of the HAC1 (homologous This improved understanding of macrolide mechanism to Atf/Creb1) transcript, which was previously shown has direct relevance to the development of newer, more to exist in a truncated form in the cytosol62, ribosome effective antibiotics. profiling showed that dom34Δ budding yeast cells accu- mulated ribosomes with abnormal footprint sizes, indiWhere? Monitoring localized translation. A hallmark of cating a defect in ribosome recycling at these sites41. eukaryotic cells is the presence of intricate subcellular The largest effect that was revealed by ribosome prostructures that facilitate the compartmentalization of dif- filing of dom34Δ cells — the presence of abundant riboferent biological processes. Localized protein synthesis some footprints in 3′ untranslated regions (3′ UTRs) on has a crucial role in creating these subcellular structures a subset of mRNAs — was unexpected. In contrast to by allowing proteins to be produced at their sites of ribosome footprints in coding regions, the footprints action and in response to local cellular need (see REF. 66

REVIEWS synthesis have been limited to bulk interrogations that Ribosome AUG mRNA AVI A A

A A cannot uniquely identify proteins or that require careful biochemical fractionation of the compartment of inter- est, which limits both the location and the resolution of analyses. Proximity-specific ribosome profiling now ena- bles in vivo measurement of localized translation within AVI Nascent peptide chain Biotinylation cells. The basis of proximity-specific ribosome profiling AAAA is selective biotinylation of ribosomes in a manner that depends on their subcellular location in intact, unper- turbed cells (FIG. 5) . The use of in vivo labelling allows the Cytosol recovery of ribosomes from defined locations, including those that cannot be purified by classical cell fractiona- ER lumen Translocon Localized tion t echniques. Combining this purification strategy biotin ligase with ribosome profiling provides a tool for the identi- fication of locally translated transcripts and sub-codon AVI monitoring of translation at the site of interest. So far, proximity-specific ribosome profiling has been AVI used to probe two processes, translocation into mitoAV I chondria and into the endoplasmic reticulum (ER), with both studies yielding unexpected results67,68. In the case Wholecell ribosome Streptavidin-pulldown of mitochondria, the approach provided insight into a profiling ribosome profiling long-standing question: do mitochondrial proteins begin translocation co-translationally, or is the predominant Recruitment of route of mitochondrial translocation post-translational? seneg ribosome to the ER Proximity-specific ribosome profiling showed that the de t + ER gene majority of mitochondrial inner membrane proteins — fo vlo ne but not proteins targeted to other mitochondrial sites rebm ser mhci

Position across ORF — were co-translationally targeted67. These studies also uN – + no re – Gene-set enrichment revealed exquisite specificity in protein trafficking, with do C n Cytosolic gene the vast majority of translocated proteins that were iden- tified being targeted exclusively to either the ER or the Figure 5 | Proximity-specific ribosome profiling at the endoplasmic reticulum (ER). A ribosome subunit is fused to a biotinacceptor (AVI) tag and BirA biotin ligase is fused to a localization element that spatially restricts its activity, for example, to the ER. Only ribosomes that orient AVI towards the ER surface, as seen during their close association with the ER membrane during protein translocation, are biotinylated when a mitochondria. A prominent exception was the fumarate reductase Osm1; follow-up studies showed that dual tar- geting of this protein resulted from the translation of alternative isoforms with distinct targeting signals67. Monitoring of translation on the ER surface deter- controlled pulse of biotin is applied to cells. Cells are then frozen and ribosomes are mined several principles that are used by cells to coordi- collected. Ribosome profiling is carried out on all ribosomes and also specifically on nate translation and ER targeting68 (FIG . 5) ribosomes pulled down with streptavidin. The pulldown-enriched mRNA population (light blue) represents genes that are greatly enriched for translation at the ER. The positional data from these analyses also reveals the point in the message at which a translating ribosome is recruited to the ER. ORF, open reading frame. Modified from Jan, CH, Williams, CC & Weissman, JS Principles of ER cotranslational translocation revealed by proximity-specific ribosome profiling. Science 346, 1257521 (2014). Reprinted with permission from AAAS. 658 | NOVEMBER 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. All rights reserved . First, this work showed that co-translational targeting to the ER is per- vasive and is principally determined by the location of the hydrophobic targeting sequence within the protein. The observation that co-translationally targeted mRNAs can be translated at the translocon immediately after or even before translation of their targeting sequence sug- gested a crucial role for polysomes in retaining mRNAs at the ER. In addition, distinct translocon complexes for a review). As translation is an important amplificaengage nascent chains at different points during syn- tion step, localization of a single mRNA molecule can thesis. ER-targeted nascent chains typically undergo a allow for correctly localized synthesis of hundreds of conformational rearrangement within the translocon protein molecules. In addition, such local synthesis prethat results in a 'looped' conformation of the nascent vents potentially toxic effects of proteins being present chains, with their amino termini facing the cytosol. — even if only during transit time — in an inappropriHowever, proximity-specific ribosome profiling revealed ate cellular compartment. Finally, localized translation that a subset of proteins, the targeting of which requires allows for the regulation of protein synthesis on the basis the translocon-associated factor secretory 66 (Sec66), of a proximal stimulus, such as that seen in dendrites in

engage the translocon only after 120 amino acids have response to neuronal stimulation, which is thought to been synthesized, which facilitates the direct adoption of contribute to the learning process66. the looped conformation. Finally, monitoring the fate of Translocon The proteinaceous tunnel through which nascent proteins cross the endoplasmic Despite the broad importance of localized translation, ER-associated ribosomes following translation termina- few gene expression analysis tools are available that faithtion using pulsed biotinylation experiments showed that fully preserve spatial information. Until recently, global any given ribosome can exchange readily between the reticulum membrane. approaches for studying subcellular control of protein ER and the cytosol, as ribosomes labelled on the ER are

REVIEWS able to access the full pool of cytosolic mRNAs following However, in diverse organisms and conditions, ribo- at most a few rounds of translation at the ER68. some footprints are seen that are organized within ORFs In principle, proximity-specific ribosome profiling that were not previously known to encode proteins, in a could be applied to any subcellular location for which manner that resembles those in canonical coding regions it is possible to target biotin ligase activity. It can also be (as in FIG. 1c ). This indicates that there is greater coding- combined with approaches that analyse different polyregion diversity and flexibility than had previously been some fractions55,69 or with the translating ribosome affinity recognized10–13. The translated ORFs that have been capture (TRAP)70–76 strategy. Together, these techniques defined by such ribosome footprints fall into two broad could make it possible to explore regulated localized categories: translated short ORFs (sORFs) in predicted translation in specific neuronal subtypes in response to intergenic regions, often on RNAs that had been pro- learning programmes. visionally characterized as non-coding; and translated ORFs encoding alternative isoforms of known proteins. What is being made? Defining translation events. Both categories could represent major emergent areas Perhaps the most surprising emergent area of discovof biologica l importance. ery that has been facilitated by ribosome profiling results from the ability of the method to identify, in a How pervasive is sORF translation? Algorithms for presystematic manner, the full set of ribosome-translated dicting protein-coding regions typically rely on assumppolypeptides in a cell. Algorithm-based analyses of the tions about translated ORF length. The minimum ORF genomic sequence of an organism alone can direct iden-

length of 100 codons that is used by most computational tification of probable coding sequences. Such strategies, annotation approaches was chosen both to minimize however, are based on assumptions about what a coding the number of false positive gene calls and to reflect the region should look like, including start and stop codon predicted biophysical folding stability of 100-amino-acid identity, splice junction cues, conservation and the total proteins relative to shorter amino acid strings. Recently, codon length of an ORF. Such approaches for identifyhowever, several short peptides have been shown to be Translating ribosome ing protein-coding genes could miss functional coding translated and to have crucial intracellular and extra- affinity capture sequences, particularly those that are short and/or specellular roles in metazoans14,82–84. Concomitant with (TRAP). A method that allows identification of translated mRNAs on the basis of their in vivo association with a tagged cies specific77. These approaches might also miss coding these findings, ribosome profiling data in several sys- regions that result from translational frame-shifting or tems, including mouse embryonic stem cells, meiotic stop codon read-through. Furthermore, translation and yeast cells, hypoxic plants and virusinfected human ribosomal subunit that is protein synthesis have effects beyond the production fibroblasts, have identified many ribosome footprints expressed in a cell type-specific manner. This method is a valuable tool for assaying tissue-specific translation in animal and plant systems. of stable proteins with discrete molecular functions. that fall outside canonical coding regions but that cover Polypeptide products from all cellular translation must short and discrete regions between an AUG and a stop be degraded, and non-canonical translation products codon10–12,16,27,85. These observations suggest that canoniyield unanticipated antigens that may have roles in viral cal protein-coding sequences may be only a subset of the detection or in autoimmunity39,78. Finally, the process sequences that are translated in cells. Nonsense-mediated decay mRNA degradation, which has traditionally been thought to result from stop codons that of translation can affect the stability of the template There are, however, some features of the newly iden- message by triggering co-translational decay pathways tified translated sORFs that have led to doubts about including nonsense-mediated decay79. Thus, knowing their authenticity. First, some are present on RNAs that terminate translation more 5' which transcripts are translated has important implicawere thought to be non-coding10– 12,82,83,86. In many cases, than is usual on an mRNA. tions for the fate of the mRNA, the ribosome and the

these sORFs are not well conserved13,87,88. They also Short ORFs (sORFs). Open reading frames cell. Ribosome profiling provides a unique opportusometimes seem to be translated in overlapping read- nity to experimentally address this question in a given ing frames10–12,87,89, a feature that has been thought to be of fewer than 100 codons on biologica l system or cell state of interest. unusual among typical eukaryotic genes (although ribo- mRNAs that are not known to Ribosome profiling data from many organisms have some profiling data have recently been used to identify encode a canonical (long) protein. sORFs are a class of ORF that have not traditionally been thought to be frequently generally provided experimental evidence for the transsuch cases among canonical genes, as well90). Finally, lation of ORFs that had already been computationally translated sORF products are difficult to detect sys- predicted to encode proteins. These data have also sugtematically using mass spectrometry approaches. The translated, although ribosome gested a diverse set of translated areas outside canonical validation or exclusion of these regions as examples of profiling and other approaches have recently validated the coding regions (reviewed in REFS 60,80 translation of thousands of sORFs in a range of organisms. biologically relevant translation has been a major recent focus of interest. Several analytical approaches to ribosome pro filing data allow rigorous testing of the degree to which ribo- ORFs encoding alternative some footprints over newly predicted translated sORFs isoforms of known proteins Open reading frames (ORFs) that differ from another ORF ). These include, in some cases, ribosome footprints that are not clearly organized within ORFs, most commonly in 5′ leader regions and mammalian long non-coding RNAs. The importance of translation of these regions remains an open question, although the unusual patterns of ribomatch those that are seen for traditional protein-codin g some footprints that are often observed suggest that they sequences (TABLE 1) at the same locus in either the may not reflect regions that are translated into canonical start codon or the stop codon peptide products. In some cases, the translation that pro- position but share the same reading frame. Translation of these ORFs may result in, for example, different subcellular duces these footprints may mediate translational regula- tion, as is the case for translation of regulatory uORFs. Alternatively, some such cases may reflect translation targeting for a similar protein. that is used to regulate mRNA stability81. NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 16 | NOVEMBER 2015 | 659 © 2015 Macmillan Publishers Limited. All rights reserved

. These analyses often examine whether ORFs that are predicted to be translated by ribosome profiling show footprint organization that is consistent with the canonical mechanism for transla- tion, such as sharp footprintabundance transitions at known start codons and stop codons, and codon perio- dicity12,13,16,38,85,87,91 (FIG. 1c;TABLE 1) (discussed in REF. 80 ).

REVIEWS Table 1 | Novel translated ORFs compared with characterized translated ORFs by diverse metrics Metric Characterized sequences Novel translated ORFs identified by ribosome profiling 660 | NOVEMBER 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. All rights reserved Refs Non-coding RNAs (such as snoRNAs, tRNAs, XIST and HOTAIR) Protein-coding sequences sORFs uORFs Association between footprint arrangement and putative start codons* No general association Footprint-covered regions usually start precisely at AUG codons, occasionally at near-cognate codons Footprint-covered regions usually start precisely at AUG codons, occasionally at near-cognate codons Footprint-covered regions often start precisely at AUG and at near-cognate codons 7,11, 12 Association between footprint arrangement and putative stop codons* No general association Footprint-covered regions stop precisely at canonical stop codons Footprint-covered regions stop precisely at canonical stop codons Footprint-covered regions stop precisely at canonical stop codons 7 Footprint abundance relative to mRNA abundance Very low (especially for properly sized footprints) Low to high, depending on translation efficiency Low to high, depending on translation efficiency Low to high, depending on translation efficiency 7,10, 13,38 Codon periodicity of footprints* No Yes Yes Often unclear owing to generally short length 7,13, 41,90 Signatures of protein-coding conservation No Often Sometimes, difficult to assess for very short regions Unclear, primarily owing to short length 13,38, 77,80, 98 Identification of protein product by mass spectrometry

No Often Sometimes (dependent on length and peptide properties) Sometimes (dependent on length and peptide properties) 11, 92–97 Stable physical association of transcript with ribosomes Not generally, but may occur in specific cases (for example, tRNAs) Yes Yes Yes 17,39 Sensitivity of footprints to translation inhibitors No Yes Yes Yes 39 FLOSS (fragment length organization similarity score)* High Low Low Low 39 % putative ORF covered by footprints* Low High High Difficult to assess owing to frequent uORF overlap 38 Inside/out ratio (local enrichment of footprints within putative ORF)* Low High High, difficult to as sess when translated sORFs overlap Difficult to assess owing to frequent uORF overlap 38 Ratio of footprints at putative start codons to footprints at immediately prior codons* Low High High High 12 RRS (ribosome release score) Poor Good Sometimes high, but particularly poor in cases of translated sORF overlap Frequent overlap in uORF translation leads to poor scores, difficult to assess 87 Cellular function determined by genetic or molecular analyses Sometimes Sometimes Rarely, thus far, but important examples exist Not assayed in many cases, but a subset are regulatory for translation of other ORFs 14, 82–84 Summary Likelihood on the basis of the above metrics that regions encode functional proteins or peptides Low High High for a subset, but unclear how generally functional the peptide products are. Likely to be a heterogeneous population with diverse roles. Unclear; uORF regions predicted to be translated by ribosome profiling probably represent true translation, but resultant peptides may not be stable. HOTAIR, HOX transcript antisense RNA; ORF, open reading frame; snoRNA, small nucleolar RNA; sORF, short ORF; uORF, upstream ORF; XIST, X inactive specific transcript. *See the glossary terms, FIG. 1c, FIG. 2 and Supplementary information S1 (figure) for class definitions and examples.

REVIEWS Most of these approaches provide support for the preand that their products are processed and presented on dicted widespread translation of short and alternative MHC molecules as functional antigens in humans, thus ORFs11– 13,15,16,38,67,85,91

(TABLE 1) . Nevertheless, even with expanding the range of epitopes displayed during viral ribosome profiling data, reliably identifying the full set of infections. The condition-specific translation of many translated ORFs remains a challenge, especially in cases sORFs suggests that they could similarly be used to dis- in which protein-coding sequences overlap. tinguish cancer cells from normal cells, with important Numerous complementary experimental approaches implications for immunomodulatory therapies. have aimed to further probe the degree to which newly The translation of some sORFs could also help to predicted protein-coding sequences represent true fuel the evolution of new proteins88. It is possible that cellular translation (TABLE 1) . So far, these approaches transcriptional noise, together with the propensity of the generally confirm that the reads that are detected in ribosome to translate capped cytosolic RNAs, may allow regions predicted to be translated by ribosome profilnovel transcripts to engage the ribosome and allow trans- ing experiments represent translating 80S ribosomes. lational sampling of new, short motifs. Initially these For example, ribosome footprints over putative transsORFs may evolve under neutral selection. However, a lated sORFs tend to respond to translation inhibitors subset could provide a small fitness advantage, resulting in a manner comparable to benchmarked translating in positive selection and possible stabilization through ribosomes39. Translated mRNA regions predicted from lengthening over time, until they resemble canonical mouse ribosome profiling data immunoprecipitate long protein-coding genes (FIG. 6c) with tagged 60S ribosomal subunits in a specific man- ner, similar to that seen for characterized translated ORFs39. This finding suggests that true translating ribo- somes produce the footprints that are detected by ribo- some profiling over ORFs not previously annotated as being translated, rather than these mRNA fragments being artefacts resulting from the protection of mRNA by scanning translation initiation complexes or alter- native RNA–protein complexes. An important open question is whether these translated regions produce stable peptides. Suggesting that they may, sORFs identi- fied as being translated by ribosome profiling that have been carboxy-terminally tagged in yeast and in human cytomegalovirus (HCMV)-infected cells can be seen to accumulate in a regulated manner that mirrors pre- dictions from ribosome profiling data11,39. Meanwhile, specialized mass spectrometry approaches continue to identify a subset of peptides resulting from such sORFs in several systems11,92–97, suggesting that at least some of these sORFs do encode abundant, stable peptides. Most convincingly, a few sORFs that were predicted to be translated from polysome association and ribo- some profiling data have now been shown to have bio- logical function14,39,83. In D. melanogaster, the peptides encoded by two such translated sORFs contained in the sarcolamban locus have been shown to directly bind to a calcium transporter in heart cells and thus regu- late normal heart function83 (FIG. 6a) NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 16 | NOVEMBER 2015 | 661 © 2015 Macmillan Publishers Limited. All rights reserved . Such regions would not necessarily be initially expected to show signatures of proteincoding conservation

(as in REF. 98 ), and many might not produce a robust mutant phenotype when disrupted, making their study challenging. How plastic is translation? Alternative isoforms abound. The results of ribosome profiling in yeast and in mam- mals have indicated that many genes may yield two or more protein variants independently of splicing, which indicates that there may be surprising flexibility in both where translation starts and where it stops in eukaryotes. Such alternative isoforms have been seen and charac- terized previously; in budding yeast, for example, both alanyl-tRNA synthetase 1 (ALA1) and glycyl-tRNA syn- thase 1 (GRS1) have been shown to exist in two isoforms, providing populations of the protein that are either cyto- solic or mitochondrial, depending on the presence or absence of an N-terminal in-frame extension99,100. These examples are also detected by ribosome pro filing12 and seem to be just a few of many10,12,67,101, supporting a model in which diverse but targeted localization might be achieved for many proteins through sometimes small alterations in the site of translation initiation18,91,101. Conversely, ribosome profiling of several yeast spe- cies, and of D. melanogaster embryos and cultured cells, revealed extensive heterogeneity in translation termina- tion sites15,102,103, resulting from regulated read-through . In zebrafish, the of hundreds of genes. As with the N-terminal-extension short protein Toddler was found to drive gastrulation isoforms, many of these C-terminal extensions are pre- Signatures of protein-coding by functioning as a secreted developmental signal14. In dicted to confer new subcellular localizations to the conservation Purifying evolutionary selection results in higher levels of synonymous than nonsynonymous substitutions, mammals, a prominent example is the several translated protei n products15,104. sORFs, predicted on the basis of ribosome profiling of Use of ribosome profiling has also facilitated the HCMVinfected human foreskin fibroblasts, that reside identification of interesting examples of regulated trun- on the β2.7 RNA, which has traditionally been defined as cated protein isoforms10–12,89. In human cells, a recent specifically among non-coding11. Peptides resulting from the translation of study identified a shortened alternative isoform of mito- homologous coding sequences. The pattern of nonsynonymous to synonymous differences two of these sORFs have been shown by mass spectromchondrial antiviral signalling protein (MAVS), which is etry to accumulate during HCMV infection. In addian important player in innate immune signalling89. The tion, analysis of serum samples from HCMV-positive alternative MAVS isoform results from translation ini- among homologous regions and HCMV-negative blood bank donors showed a tiation downstream of the canonical start site to create compared in a phylogenetic group can be used to predict the likelihood that a genomic locus encodes a translated robust immune response to the peptides produced an in-frame truncation, which the authors term 'mini- from several of these β2.7 sORFs, specifically in the MAVS'. Whereas full-length MAVS induces interferon HCMVpositive individuals39 (FIG. 6b) . This result sugproduction, miniMAVS antagonizes MAVS function by

open reading frame (ORF). gests that the ribosome-occupied sORFs are translated, interfering with such production.

REVIEWS a Regulation of larger protein activity b Antigens MHC Cardiac kymograph Antigenclass II presenting T cell cell – sarcolamban egatlo V Peptide from sORF on HCMV β2.7 RNA Ca-P60A SERCA cardiac calcium transporter c An evolutionary pool for new protein function Time Translation sORF + sarcolamban Sarcolamban peptide A or B Time Figure 6 | Proposed cellular roles for the peptide products of translated short open reading frames (sORFs) identified by ribosome profiling. a | The two sarcolamban peptides are 28 and 29 amino acids in length, are conserved from fruit flies to human and regulate normal heart function in flies through direct binding to the sarcoendoplasmic reticulum Ca2+ ATPase (SERCA) calcium transporter Ca-P60A in cardiac tissue. b | Sera from human cytomegalovirus (HCMV)-positive blood donors were used to identify a specific and robust immune response against multiple short peptides translated from the β2.7 RNA, which was previously thought to be a non-coding RNA. c | Spurious translation of short regions may produce a pool of peptides with weak or no cellular function. New protein domains may evolve through selection for maintenance of peptides with weak cellular function, followed by stop codon mutation and further selection for increasingly specific and important cellular function over time. Part a from Magny, EG et al. Conserved regulation of cardiac calcium uptake by peptides encoded in small open reading frames. Science 341, 1116–1120 (2013). Redrawn with permission from AAAS. 662 | NOVEMBER 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. All rights reserved Function of protein dnanoita em sORF in cell None or minimal, nonspecific egatl tum itrev Weak, specific o V nodoc onoitc sORF or ORF Strong, specific pot S eles ORF Strong, specific

The large and diverse set of unconventional regions of instantaneous measurement of all translational control in translation suggested by ribosome profiling shows that a given system, providing a tool for broad discovery of the there is considerably more to translational regulation underlying biology of a cellular process or state of choice. and cellular content than was previously known. Some Furthermore, the detailed information that is yielded by of these regions are likely to be translated into functional this method provides valuable insight into fundamental proteins, but it is likely that others will not produce staaspects of how translation works. Despite the conserved ble protein products that are similar to those from tranature of much of the translation machinery, important ditional genes. Rather, subsets of these newly identified open questions about the mechanism of protein syn- regions of translation may have regulatory, immune thesis remain, including the basis for most specificity of or currently neutral cellular roles. Unravelling the set translation among different mRNAs and the connections of functions that are carried out by translated genomic between translation and nascent protein folding. regions poses a fascinating and daunting challenge. Finally, owing to the precise genomic positional information provided by ribosome profiling, the pro- Perspective tein-coding capacity of genomes can now be defined Protein synthesis consumes a large proportion of celluexperimentally. This has led to the identification of a lar resources and is central to almost every function of a broad range of non-canonical translation events, includ- cell. Ribosome profiling allows, for the first time, in vivo ing the translation of novel sORFs and alternative forms and global measurement of translation, providing a preof previously annotated proteins, thereby challenging cise and quantitative account of what cells are translating, traditional views of protein-coding regions and gene how this translation is regulated, and when and where diversity. Analytical advances that facilitate more com- translation happens. The rich and quantitative nature of prehensive identification of other non-canonical transla- ribosome profiling data provide an unprecedented opportion events, such as those resulting from frame-shifting tunity to explore and model complex cellular processes. and stop codon read-through will continue to expand our Although it has long been known that translational understanding of the protein-coding capacity of complex regulation has important roles in development, in cellugenomes. The functions of the many novel short and lar responses to stimuli and in disease, the limited numalternatively translated regions that have been identified ber of well-studied examples of regulation at the level of so far by ribosome profiling remain an intriguing and protein synthesis have generally been identified in an largely open question, the answer to which could funda- ad hoc manner. When paired with RNA-seq measure-

mentally change the way we think about the encoding of ments of mRNA levels, ribosome profiling now allows information in genomes. Newly available CRISPR-based

REVIEWS methods105 now make it possible to shut down the expres- sion of any transcript106–109 or to introduce nonsense mutations into any ORF. As such, these approaches provide a central tool for efforts to define the functional roles of this broad array of newly identified translation products. Specialized alterations to ribosome profiling that will advance its use in complex systems include the analy- sis of subsets of ribosomes, either those associated with NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 16 | NOVEMBER 2015 | 663 © 2015 Macmillan Publishers Limited. All rights reserved specific factors or protein modifications, or those in increasingly specific cell types or subcellular locations. Further transformative advances are likely to emerge from progressively more sophisticated and creative anal- ysis of the rich data sets that are generated from ribo- some profiling experiments, allowing major surprises to be revealed, even in systems that were thought to be well characterized. 1. McCann, KL & Baserga, SJ Mysterious ribosomopathies. Science 341, 849–850 (2013). 2. Cleary, JD & Ranum, LPW Repeat-associated non-ATG (RAN) translation in neurological disease. Hum. Mol. Genet. 22, R45–R51 (2013). 3. Ellis, SR Nucleolar stress in Diamond Blackfan anemia pathophysiology. Biochim. Biophys. Acta 1842, 765–768 (2014). 4. Trainor, PA & Merrill, AE Ribosome biogenesis in skeletal development and the pathogenesis of skeletal disorders. Biochim. Biophys. Acta 1842, 769–778 (2014). 5. Bolze, A. et al. Ribosomal protein SA haploinsufficiency in humans with isolated congenital asplenia. Science 340, 976–978 (2013). 6. Kondrashov, N. et al. Ribosome-mediated specificity in Hox mRNA translation and vertebrate tissue patterning. Cell 145, 383–397 (2011). 7. Ingolia, NT, Ghaemmaghami, S., Newman, JRS & Weissman, JS Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324, 218–223 (2009). This work defines the ribosome profiling method and details its specificity, precision and utility. 8. Wolin, SL & Walter, P. Ribosome pausing and stacking during translation of a eukaryotic mRNA. EMBO J. 7, 3559–3569 (1988). 9. Steitz, JA Polypeptide chain initiation: nucleotide sequences of the three ribosomal binding sites in bacteriophage R17 RNA. Nature 224, 957–964 (1969). 10. Ingolia, NT, Lareau, LF & Weissman, JS Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell 147, 789–802 (2011). 11. Stern-Ginossar, N. et al. Decoding human cytomegalovirus. Science 338, 1088–1093 (2012). 12. Brar, GA et al. High-resolution view of the yeast meiotic program revealed by ribosome profiling. Science 335, 552–557 (2012). References 11 and 12 describe the application of ribosome profiling to physiological dynamic cellular processes, the HCMV infection cycle in human cells and meiosis in budding yeast, respectively. In these disparate systems, both studies identified many new examples of translational control, uORF translation and the translation of many sORFs and alternative ORFs in genomic regions that were thought to be non-coding. 13. Bazzini, AA et al. Identification of small ORFs in vertebrates using ribosome footprinting and evolutionary conservation. EMBO J. 33, 981–993 (2014). 14. Pauli, A. et al. Toddler: an embryonic signal that promotes cell movement via Apelin receptors. Science 343, 1248636 (2014). 15. Dunn, JG, Foo, CK, Belletier, NG, Gavis, ER & Weissman, JS Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster. eLife 2, e01179 (2013). 16. Aspden, JL et al. Extensive translation of small open reading frames revealed by Poly-Ribo-Seq. eLife 3, e03528 (2014). 17. Smith, JE et al. Translation of small open reading frames within unannotated RNA transcripts in Saccharomyces cerevisiae. Cell Rep. 7, 1858–1866 (2014). 18. Lee, S. et al. Global mapping of translation initiation sites in mammalian cells at single-nucleotide resolution. Proc. Natl Acad. Sci. USA 109, E2424–E2432 (2012). 19. Andreev, DE et al. Translation of 5′ leaders is pervasive in genes resistant to eIF2 repression. eLife 4, e03971 (2014). 20. Van Dijk, EL, Auger, H., Jaszczyszyn, Y. & Thermes, C. Ten years of next-generation sequencing technology. Trends Genet. 30, 418–426 (2014). 21. Ingolia, NT, Brar, GA, Rouskin, S., McGeachy, AM

& Weissman, JS The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosomeprotected mRNA fragments. Nat. Protoc. 7, 1534–1550 (2012). 22. Kuersten, S., Radek, A., Vogel, C. & Penalva, LO Translation regulation gets its 'omics' moment. Wiley Interdiscip. Rev. RNA 4, 617–630 (2013). 23. Oh, E. et al. Selective ribosome profiling reveals the cotranslational chaperone action of trigger factor in vivo. Cell 147, 1295–1308 (2011). 24. Arias, C. et al. KSHV 2.0: a comprehensive annotation of the Kaposi's sarcoma-associated herpesvirus genome using next-generation sequencing reveals novel genomic and functional features. PLoS Pathog. 10, e1003847 (2014). 25. Stadler, M. & Fire, A. Wobble base-pairing slows in vivo translation elongation in metazoans. RNA 17, 2063–2073 (2011). 26. Bazzini, AA, Lee, MT & Giraldez, AJ Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish. Science 336, 233–237 (2012). 27. Juntawong, P., Girke, T., Bazin, J. & Bailey-Serres, J. Translational dynamics revealed by genome-wide profiling of ribosome footprints in Arabidopsis. Proc. Natl Acad. Sci. USA 111, E203–E212 (2014). 28. Jensen, BC et al. Extensive stage-regulation of translation revealed by ribosome profiling of Trypanosoma brucei. BMC Genomics 15, 911 (2014). 29. Caro, F., Ahyong, V., Betegon, M. & DeRisi, JL Genome-wide regulatory dynamics of translation in the Plasmodium falciparum asexual blood stages. eLife 3, e04106 (2014). 30. Schafer, S. et al. Translational regulation shapes the molecular landscape of complex disease phenotypes. Nat. Commun. 6, 7200 (2015). 31. Rooijers, K., Loayza-Puch, F., Nijtmans, LG & Agami, R. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation. Nat. Commun. 4, 2886 (2013). 32. Zoschke, R., Watkins, KP & Barkan, A. A rapid ribosome profiling method elucidates chloroplast ribosome behavior in vivo. Plant Cell 25, 2265–2275 (2013). 33. Michel, AM et al. GWIPS-viz: development of a riboseq genome browser. Asam Nukleat Res. 42, D859–D864 (2014). 34. Liu, X., Jiang, H., Gu, Z. & Roberts, JW Highresolution view of bacteriophage lambda gene expression by ribosome profiling. Proc. Natl Acad. Sci. USA 110, 11928– 11933 (2013). 35. Gerashchenko, MV, Lobanov, AV & Gladyshev, VN Genome-wide ribosome profiling reveals complex translational regulation in response to oxidative stress. Proc. Natl Acad. Sci. USA 109, 17394–17399 (2012). 36. Li, G.-W., Oh, E. & Weissman, JS The anti-Shine– Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484, 538–541 (2012). 37. Woolstenhulme, CJ, Guydosh, NR, Green, R. & Buskirk, AR High-precision analysis of translational pausing by ribosome profiling in bacteria lacking EFP. Cell Rep. 11, 13–21 (2015). 38. Chew, G.-L. et al. Ribosome profiling reveals resemblance between long non-coding RNAs and 5′ leaders of coding RNAs. Development 140, 2828–2834 (2013). 39. Ingolia, NT et al. Ribosome profiling reveals pervasive translation outside of annotated protein- coding genes. Cell Rep. 8, 1365–1379 (2014). 40. Andreev, DE et al. Oxygen and glucose deprivation induces widespread alterations in mRNA translation within 20 minutes. Genome Biol. 16, 90 (2015). 41. Guydosh, NR & Green, R. Dom34 rescues ribosomes in 3′ untranslated regions. Cell 156, 950–962 (2014). 42. Shalgi, R. et al. Widespread regulation of translation by elongation pausing in heat shock. Mol. Cell 49, 439–452 (2013). 43. Han, Y. et al. Ribosome profiling reveals sequenceindependent post-initiation pausing as a signature of translation. Sel Res. 24, 842–851 (2014). 44. Liu, B., Han, Y. & Qian, S.-B. Cotranslational response to proteotoxic stress by elongation pausing of ribosomes. Mol. Cell 49, 453–463 (2013). 45. Subramaniam, AR, Zid, BM & O'Shea, EK An integrated approach reveals regulatory controls on bacterial translation elongation. Cell 159, 1200–1211 (2014). This work probes position-specific changes in ribosome distribution among various cellular conditions, concluding that tRNA abundances do not account for elongation rates for most codons, and that pausing of ribosomes during starvation may result in translation abortion. 46. Lareau, LF, Hite, DH, Hogan, GJ & Brown, PO Distinct stages of the translation elongation cycle revealed by sequencing ribosome-protected mRNA fragments. eLife 3, e01257 (2014). This work identifies a class of short ribosome footprints that may be enriched by treatment with translation elongation inhibitors and that are likely to represent a distinct conformation of the ribosome at a specific stage of the elongation cycle. 47. Siegel, AF, van den Engh, G., Hood, L., Trask, B. & Roach, JC Modeling the feasibility of whole genome shotgun sequencing using a pairwise end strategy. Genomics 68, 237– 246 (2000). 48. Roberts, A., Schaeffer, L. & Pachter, L. Updating RNA-

Seq analyses after re-annotation. Bioinformatics 29, 1631–1637 (2013). 49. Saliba, A.-E., Westermann, AJ, Gorski, SA & Vogel, J. Single-cell RNA-seq: advances and future challenges. Asam Nukleat Res. 42, 8845–8860 (2014). 50. Green &, R. & Noller, HF Ribosomes and translation. Annu. Rev. Biochem. 66, 679–716 (1997). 51. Li, G.-W., Burkhardt, D., Gross, C. & Weissman, JS Quantifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell 157, 624–635 (2014). 52. Aris, JP, Klionsky, DJ & Simoni, RD The synthase F o subunits are sufficient of the Escherichia to form a functional coli F 1 F o -ATP proton pore. J. Biol. Chem. 260, 11207–11215 (1985). 53. Humphryes, N. et al. The Ecm11–Gmc2 complex promotes synaptonemal complex formation through assembly of transverse filaments in budding yeast. PLoS Genet. 9, e1003194 (2013). 54. Lee, MT et al. Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature 503, 360–364 (2013). 55. Kronja, I. et al. Widespread changes in the posttranscriptional landscape at the Drosophila oocyte-to-embryo transition. Cell Rep. 7, 1495–1508 (2014). 56. Vasquez, J.J., Hon, C.-C., Vanselow, JT, Schlosser, A. & Siegel, TN Comparative ribosome profiling reveals extensive translational complexity in different Trypanosoma brucei life cycle stages. Asam Nukleat Res. 42, 3623–3637 (2014).

REVIEWS 664 | NOVEMBER 2015 | VOLUME 16 www.nature.com/reviews/molcellbio © 2015 Macmillan Publishers Limited. All rights reserved 57. Stumpf, CR, Moreno, MV, Olshen, AB, 77. Reinhardt, JA & Jones, CD Two rapidly evolving 96. Menschaert, G. et al. Deep proteome coverage based Taylor, BS & Ruggero, D. The translational landscape genes contribute to male fitness in Drosophila. on ribosome profiling aids mass spectrometry-based of the mammalian cell cycle. Mol. Cell 52, 574–582 J. Mol. Evol. 77, 246–259 (2013). protein and peptide discovery and provides evidence (2013). 78. Starck, SR et al. Leucine-tRNA initiates at CUG start of alternative translation products and near-cognate 58. Stadler, M. & Fire, A. Conserved translatome codons for protein synthesis and presentation by MHC translation initiation events. Mol. Cell. Proteomics 12, remodeling in nematode species executing a shared class I. Science 336, 1719–1723 (2012). 1780–1790 (2013). developmental transition. PLoS Genet. 9, e1003739 79. Rebbapragada, I. & Lykke-Andersen, J. Execution of 97. Vanderperre, B. et al. Direct detection of alternative (2013). nonsense-mediated mRNA decay: what defines a open reading frames translation products in human 59. Liu, B. & Qian, S.-B. Translational reprogramming in substrate? Curr. Opin. Sel Biol. 21, 394–402 (2009).

significantly expands the proteome. PLoS ONE 8, cellular stress response. Wiley Interdiscip. Rev. RNA 5, 80. Pauli, A., Valen, E. & Schier, AF Identifying (non-) e70698 (2013). 301–305 (2014). coding RNAs and small peptides: challenges and 98. Lin, MF, Jungreis, I. & Kellis, M. PhyloCSF: a 60. Ingolia, NT Ribosome profiling: new views of opportunities. BioEssays 37, 103–112 (2015). comparative genomics method to distinguish protein translation, from single codons to genome scale. 81. Ulitsky, I. & Bartel, DP lincRNAs: genomics, coding and non-coding regions. Bioinformatics 27, Nat. Rev. Genet. 15, 205–213 (2014). evolution, and mechanisms. Cell 154, 26–46 i275–i282 (2011). 61. Michel, AM & Baranov, PV Ribosome profiling: a (2013). 99. Huang, H.-Y., Tang, H.-L., Chao, H.-Y., Yeh, L.-S. & Hi-Def monitor for protein synthesis at the genome82. Kondo, T. et al. Small peptides switch the transcriptional Wang, C.-C. An unusual pattern of protein wide scale. Wiley Interdiscip. Rev. RNA 4, 473–490 activity of Shavenbaby during Drosophila expression and localization of yeast alanyl-tRNA (2013). embryogenesis. Science 329, 336–339 (2010). synthetase isoforms. Mol. Microbiol. 60, 189–198 62. Cox, JS & Walter, P. A novel mechanism for This paper identifies key roles in fly development (2006). regulating activity of a transcription factor that for several short peptides (from 11 to 32 amino 100. Chang, K.-J. & Wang, C.C. Translation initiation from a controls the unfolded protein response. Cell 87, acids) translated from sORFs on a transcript that naturally occurring nonAUG codon in Saccharomyces 391–404 (1996). was previously thought to be non-coding. cerevisiae. J. Biol. Chem. 279, 13778–13785 63. Kannan, K. et al. The general mode of translation 83. Magny, EG et al. Conserved regulation of cardiac (2004). inhibition by macrolide antibiotics. Proc. Natl Acad. calcium uptake by peptides encoded in small open 101. Wan, J. & Qian, S.-B. TISdb: a database for alternative Sci. USA 111, 15958–15963 (2014). reading frames. Science 341, 1116–1120 (2013). translation initiation in mammalian cells. Nucleic Acids 64. Kannan, K., Vázquez-Laslop, N. & Mankin, AS 84. Anderson, DM et al. A micropeptide encoded by a

Res. 42, D845–D850 (2014). Selective protein synthesis by ribosomes with a putative long noncoding RNA regulates muscle This work presents a database of alternative drug-obstructed exit tunnel. Cell 151, 508–520 (2012). performance. Cell 160, 595–606 (2015). translation initiation sites that have been identified 65. Davis, AR, Gohara, DW & Yap, M.-NF Sequence 85. Ruiz-Orera, J., Messeguer, X., Subirana, JA & by ribosome profiling in mammalian cells. selectivity of macrolide-induced translational Alba, MM Long non-coding RNAs as a source of 102. Artieri, CG & Fraser, HB Evolution at two levels of attenuation. Proc. Natl Acad. Sci. USA 111, new peptides. eLife 3, e03523 (2014). gene expression in yeast. Genome Res. 24, 411–421 15379–15384 (2014). 86. Xu, Y. & Ganem, D. Making sense of antisense: (2014). 66. Jung, H., Gkogkas, CG, Sonenberg, N. & Holt, CE seemingly noncoding RNAs antisense to the master 103. Jungreis, I. et al. Evidence of abundant stop codon Remote control of gene function by local translation. regulator of Kaposi's sarcoma-associated herpesvirus readthrough in Drosophila and other metazoa. Cell 157, 26–40 (2014). lytic replication do not regulate that transcript but Genome Res. 21, 2096– 2113 (2011). 67. Williams, CC, Jan, CH & Weissman, JS serve as mRNAs encoding small peptides. J. Virol. 84, 104. Schueren, F. et al. Peroxisomal lactate dehydrogenase Targeting and plasticity of mitochondrial proteins 5465–5475 (2010). is generated by translational readthrough in revealed by proximity-specific ribosome profiling. 87. Guttman, M., Russell, P., Ingolia, NT, Weissman, JS mammals. eLife 3, e03640 (2014). Science 346, 748–751 (2014). & Lander, ES Ribosome profiling provides evidence 105. Jinek, M. et al. A programmable dual-RNA-guided 68. Jan, CH, Williams, CC & Weissman, JS that large noncoding RNAs do not encode proteins. DNA endonuclease in adaptive bacterial immunity. Principles of ER cotranslational translocation revealed Cell 154, 240–251 (2013). Science 337, 816–821 (2012). by proximity-specific ribosome profiling. Science 346, 88. Carvunis, A.-R. et al. Proto-genes and de novo gene 106. Zalatan, JG et al. Engineering complex synthetic 1257521 (2014). birth. Nature 487, 370–374 (2012).

transcriptional programs with CRISPR RNA scaffolds. 69. Arava, Y. et al. Genome-wide analysis of mRNA In this work, the authors present evidence to Cell 160, 339–350 (2015). translation profiles in Saccharomyces cerevisiae. support the protogene hypothesis, according to 107. Gilbert, LA et al. CRISPRmediated modular Proc. Natl Acad. Sci. USA 100, 3889–3894 (2003). which new proteins can evolve through the selection RNA-guided regulation of transcription in eukaryotes. 70. Heiman, M., Kulicke, R., Fenster, RJ, Greengard, P. & and elongation of ORFs encoding peptides Cell 154, 442–451 (2013). Heintz, N. Cell type-specific mRNA purification by translated from putative intergenic transcripts. 108. Gilbert, LA et al. Genomescale CRISPR-mediated translating ribosome affinity purification (TRAP). 89. Brubaker, SW, Gauthier, AE, Mills, EW, control of gene repression and activation. Cell 159, Nat. Protoc. 9, 1282–1291 (2014). Ingolia, NT & Kagan, JC A bicistronic MAVS 647–661 (2014). 71. Heiman, M. et al. A translational profiling approach transcript highlights a class of truncated variants in 109. Qi, LS et al. Repurposing CRISPR as an RNA-guided for the molecular characterization of CNS cell types. antiviral immunity. Cell 156, 800–811 (2014). platform for sequencespecific control of gene Cell 135, 738–748 (2008). 90. Michel, AM et al. Observation of dually decoded expression. Cell 152, 1173–1183 (2013). 72. Inada, T. et al. One-step affinity purification of the regions of the human genome using ribosome profiling yeast ribosome and its associated proteins and data. Genome Res. 22, 2219–2229 (2012). Acknowledgements mRNAs. RNA 8, 948–958 (2002). 91. Noderer, WL et al. Quantitative analysis of The authors wish to thank C. Jan and E. Ünal for helpful com- 73. Zanetti, ME, Chang, I.-F., Gong, F., Galbraith, DW mammalian translation initiation sites by FACS-seq. ments on this manuscript and N. Ingolia for development of & Bailey-Serres, J. Immunopurification of Mol. Syst. Biol. 10, 748 (2014). the original ribosome profiling protocol and helpful discus- polyribosomal complexes of Arabidopsis for global 92. Schwaid, AG et al. Chemoproteomic discovery of sions. This work was partially supported by the Winkler analysis of gene expression. Tanaman Physiol. 138, cysteine-containing human short open reading

Family Biological Sciences Award to GAB and Howard 624–635 (2005). frames. Selai. Chem. Soc. 135, 16750–16753 Hughes Medical Institute and Center for RNA Systems 74. Mustroph, A., Zanetti, ME, Girke, T. & (2013). Biology funding to JSW BaileySerres, J. Isolation and analysis of mRNAs 93. Slavoff, SA et al. Peptidomic discovery of short open from specific cell types of plants by ribosome reading frame-encoded peptides in human cells. Competing interests statement immunopurification. Methods Mol. Biol. 959, Nat. Chem. Biol. 9, 59–64 (2013). The authors declare competing interests: see Web version 277–302 (2013). 94. Ma, J. et al. Discovery of human sORF-encoded for details. 75. Thomas, A. et al. A versatile method for cell-specific polypeptides (SEPs) in cell lines and tissue. profiling of translated mRNAs in Drosophila. J. Proteome Res. 13, 1757–1765 (2014). PLoS ONE 7, e40276 (2012). 95. Crappé, J. et al. Combining in silico prediction and SUPPLEMENTARY INFORMATION 76. Housley, MP et al. Translational profiling through ribosome profiling in a genome-wide search for See online article: S1 (figure) biotinylation of tagged ribosomes in zebrafish. Development 141, 3988–3993 (2014). novel putatively coding sORFs. BMC Genomics 14, 648 (2013). ALL LINKS ARE ACTIVE IN THE ONLINE PDF