Plant And Animal Breeding

Plant and Animal Breeding

Artificial Selection & Breeding for selected traits selection

of plants or animals for desirable traits by humans through carefully planned breeding

Artificial Selection & Breeding for selected traits

Isolation of natural populations ↓ Selective breeding of organisms showing traits useful of humans ↓ Useful genotypes exits more often (producing more offspring) than other genotype ↓ Change in allele frequency towards genotypes useful to humans

Aims of artificial selection 1.

create new breeds or varieties

Aims of artificial selection preserve

good species

Aims of artificial selection domesticate

animals Wildebeest

wild plants and Ostrich

Common types of artificial selection Inbreeding Outbreeding Polyploidy

Inbreeding mating

between genetically closely related individuals increase the number of homozygous genotypes ◦ reduced variability ◦ decrease in heterozygosity

Inbreeding self-fertilization crossing

the offspring of the same parents backcrossing with one of the parents

Inbreeding decrease

heterozygous genotypes by 50% in each generation

Problems of inbreeding reduce

in fertility Inbreeding depression - vigour of the population is gradually reduced

Outbreeding mating

between genetically closely unrelated individuals increase the number of heterozygosity ◦ more variations ◦ produce offspring with superior character (hybrid vigour) use

in combining two beneficial characteristics

Polyploidy Autopolyploidy

◦ chromosome sets derived from the same species ◦ created by spontaneous duplication Allopolyploidy

Polyploidy Autopolyploidy

◦ chromosome sets derived from the same species ◦ created by spontaneous duplication

Polyploidy Allopolyploidy

◦ two different diploid species are interbred

Allopolyploidy the

hybrid form is sterile

◦ different sets of chromosomes from both parents are not homologous ◦ no pairing during meiosis

Allopolyploidy duplicate

the genome the tetraploid became fertile

Allopolyploidy get

the advantage of inheriting desirable characteristics from both parents can be induced artificially by colchicine ◦ inhibit spindle formation

Methods commonly used in plant breeding Selection Backcross Hybridization Polyploid

breeding Mutation breeding

Methods commonly used in animal breeding Selection Artificial

insemination

Artificial insemination Collection

of semen from a male Dilution and artificial introduction of sperm into female reproductive tract Horses - Artificial Insemination

Artificial insemination the

semen can be stored in liquid nitrogen for a long time one male can be used to fertilize a large number of females semen can be sent over long distances commonly used in cattle breeding

Plant cloning A

clone is a group of genetically identical cells or an individual derived from a single ancestral cell, tissue or individual by repeated asexual divisions Cloning is the production of genetically identical individuals

Cloning is naturally occurring Organisms

which reproduce asexually give rise to progeny by mitotic nuclear division e.g. binary fission, vegetative propagation produces exact copies of the parental genotype Gardeners frequently maintain clones of desirable varieties of plants by vegetative propagation.

Plant cloning Materials needed for cloning: Somatic cells (primordial cells) Culture medium

Tissue culture Each somatic cell contains all the information required to code for an entire organism. • The cells to be cloned are allowed to grow in a medium containing suitable nutrients and hormones to form a mass of genetically identical cells called callose. •

The callose are then separated and induced to produce new individuals

Advantages of plant cloning maintain

desirable traits in selected plants rapid way of propagating plants in a short period of time plants are grown in sterile medium (disease-free)

Advantages of plant cloning plants

are grown in sterile medium (disease-free)

Advantages of plant cloning maintain

the genetic uniformity less space is needed

Animal cloning First

clone animal (1997) by Professor Ian Wilmut works at the Roslin Institute in Edinburgh, which specializes in research on farm and other animals

Animal cloning - Dolly An

unfertilized egg was collected from a Scottish blackface sheep

Animal cloning - Dolly The

nucleus of the unfertilized egg cells was removed (enucleated)

Animal cloning The

nucleus from a mammary gland cell taken from a sheep Y.

Cloning of Dolly The

nucleus transfer to the enucleated cell. An electro fusion was given

Cloning of Dolly Incubate

the new cell in a culture medium for 6 days ◦ embryo formed

Cloning of Dolly The

embryo was implanted into the uterus of another blackface sheep (surrogate / foster mother)

Cloning of Dolly The

foster mother gave birth to Dolly (baby sheep)

Implications of animal cloning maintain

the desirable traits in selected animals Increase the population of endangered species

Cloning on extinct animal Thylacine

- the largest known carnivorous marsupial of modern times Native to Australia and New Guinea

What’s the next?

Implications of animal cloning tissue

from cloning of human embryo for curing Parkinson’s disease

Implications of animal cloning

Recombinant DNA technology

Transferring a particular gene to a self-replicating chromosome (usually in bacteria) 2. Amplification of the resulting recombinant DNA molecule 1.

Recombinant DNA technology

Recombinant DNA technology

Transferring a particular gene to a self-replicating chromosome (usually in bacteria) 2. Amplification of the resulting recombinant DNA molecule 1.

Recombinant DNA technology also called  gene manipulation  genetic engineering

Genetic Engineering

Basic steps of recombinant DNA technology identifying

a target gene isolating the target gene inserting the target gene into a vector transferring the vector containing the target gene into a host cell for producing a certain gene product harvesting and purifying the gene product

Isolate the target gene use

restriction enzymes produced by bacteria which cut on the DNA at particular sites (recognition sites)

1978 Nobel Prize Physiology or Medicine Werner Arber Hamilton Smith Daniel Nathans

Restriction enzymes can

be extracted from bacterial cultures cut the double helix at specific sites along the sequences most recognize sequences of DNA with 4, 6 or 8 bases

Donor DNA (Target DNA) Restriction enzymes (restriction endonucleases)

Break at specific site

Restriction enzymes act

as powerful scissors create sticky ends

Formation of recombinant DNA molecule apply

the restriction enzyme in vitro with 2 different DNA fragments

DNA ligase can

join ‘sticky ends’ of the DNA fragments

Ways to locate the genes Short

gun sequencing Top-down sequencing

Shotgun approach Genome from an organism Restriction enzymes

Fragments of DNA (some just contains the base sequences of a gene) Gene probe

Desired base sequence

Shotgun approach •

not specific

•

but useful when no idea about the sequence of the desired gene

Shotgun sequencing DNA

is broken up randomly into numerous small segments sequenced using the chain termination method Multiple overlapping reads for the target DNA are obtained

Shotgun sequencing Strand

Sequence

Original First shotgun sequence Second shotgun sequence Reconstructi on

XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX XXXAGCATGCTGCAGTCATGCTXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXTAGGCTAXXXX XXXAGCATGXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXCTGCAGTCATGCTTAGGCTAXXXX XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

Bottom up sequencing

Complementary DNA (cDNA) conversion

of mRNA into DNA can be used to find out the location of gene

Protein

Amino acids sequence

Nucleotides sequence Only restricted to small gene with short DNA

Structure of mRNA with

all

a poly A tail d

eukaryotic mRNA molecules contain a poly-A tail for stabilization of mRNA molecule during transcription

cDNA using

a poly-T oligomer as a primer (Primer is a short single-stranded DNA or RNA that functions as the starting site for the elongation of a new chain)

cDNA The

poly-T oligomer binds to the complementary poly-A tail of mRNA

Formation of cDNA In

the presence of enzyme ,reverse transcriptase a single strand of cDNA copy is formed

Release of the cDNA cDNA

can be released by the addition of alkali

Synthesis of DNA double helix with

the help of DNA polymerase

Vectors a

self-replicating DNA molecule that carries a foreign DNA segment to a host cell for amplification come from bacterial plasmids and viruses

Plasmid a

small circular molecule of double stranded DNA present in bacterial cell carries a minor fraction of the bacterial genome ◦ code important traits

Advantages of using plasmid as vector low

molecular weight (contains several thousand base pairs)

Advantages of using plasmid as vector plasmid

replicates autonomously independent of the chromosomes in bacteria

Advantages of using plasmid as vector contains

antibiotic resistance genes which facilities selection

Advantages of using plasmid as vector contain

a number of unique cleavage sites for the actions of several different restriction enzymes

Isolation of plasmid from bacteria by

breaking up the bacterial cells separation by centrifugation

Cleavage of plasmid cleavage

by the same restriction enzyme used in cutting the short length of DNA (target gene) to be inserted form the same sticky ends

Insertion of plasmid to host cell with

the help of DNA ligase

Insertion of plasmid to host cell the

resulting plasmids can be replicated if they are introduced into a bacterial host cells

Introducing the target gene into the host cell DNA

molecules can be taken up by pre-treating the bacterial cells with a solution containing Ca2+ ions followed by a rapid heat shock(42oC)

Introducing the target gene into the host cell apply

a brief electrical shock that generates temporary pores in the bacterial cell membrane

Production of human insulin from genetically engineered bacteria Type I Diabetes ◦ failed to produce sufficient insulin ◦ due to insufficient insulin by Islets of Langerhans in the pancreas ◦ can only get insulin from the panaceas from cows or pigs

Problems of using insulin from other animals though

the insulin is biologically active but the amino acid sequences are slightly different from those of humans some patients are stimulated to produce antibodies against the injected insulin

Structure of human insulin consists

of two separate polypeptides chains: A and B joined together by special disulphide bridges (S~S) A-chain contains 21 amino acids B-chain is 30 amino acids long

Structure of human insulin two

chains originate from a large gene product called preproinsulin

Structure of human insulin function

of C-chain is to bring the A-chain and B-chain together in the correct alignment

Structure of human insulin A-chain

and B-chain will join to form a mature insulin

Genetically engineered human insulin isolate

2 synthetic DNA fragments (genes) ◦ encoding A-chain and B-chain

Introduce

plasmids

the 2 genes into

Genetically engineered human insulin the

plasmids are introduced into 2 E. coli bacteria produce the chain A and chain B polypeptides separately

Genetically engineered human insulin the

polypeptides are extracted and purified mixed under appropriate conditions to produce functional human insulin

Applications of recombinant DNA technology Production of therapeutic proteins for pharmaceutical uses ◦ ◦ ◦ ◦

Human insulin Blood clotting factor VIII Human growth hormone Protein coat of hepatitis B virus

Diagnosis of genetic diseases compare

the nucleotides sequences of affected patients and unaffected individuals ◦ ◦ ◦ ◦ ◦

diabetes pancreas cancer cystic fibrosis haemophilia AIDS

Production of enzymes for industrial applications biological

detergents

◦ protease and amylase Brewing

industry Textile industry Baking industry ◦ cellulase Leather

industry

Transgenic technology transfer

a desirable gene from another species to a recipient organism form a new character which is beneficial to human produce transgenic animals and transgenic plants Genetically Modified Organisms (GMO)

• Introducing new genes from another organism

Bt gene

DNA Fingerprinting

Sir Professor Alec Jeffreys

Background information No. of base pairs in human: 3 billion No. of coding gene: 30,000  about 95% of the base pairs are non-coding  about 30-40% of the base pairs consists of short sequence of repeats some of the repeats are joined together in cluster (tandem)

DNA fingerprinting On

the DNA there are region which do not code for polypeptides ◦ Exon – coded for polypeptide ◦ Intron – non-coding DNA sequences

Non-coding sequence make

up over 90% of the genome about half of them carry short repetitive sequences of nucleotides – tandem repeats

The tandem repeats are known as satellite DNA. Some just have a small number of repeats: minisatillites. • Different individual have a different number of tandem repeated • Minisatillate known as variable number tandem repeats (VNTRs)

Procedure Extraction

Amplification: Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) 1. Denature: made single-stranded 2. Add DNA polymerase 3. Add primer (a short DNA sequence)

Treatment with restriction enzyme • cut DNA into smaller fragments • contain minisatellites • length of the DNA fragments remains unchanged

Agrose gel electrophoresis • agrose gel with pores • Separate the DNA fragments according to size • DNA carries negative charge and will move to positive pole if a voltage is applied to it. • Smaller size: move faster • Bigger size: move slower

Splitting the DNA into single strands • by alkaline treatment

Addition of a radioactive probe • Identify the location of the minisatillites • number of tandem repeats can be shown as bands

Applications of DNA fingerprinting • Identification of criminal • very sensitive Typeof sample Blood

Amountof DNA (ng); 1ng=10-9 g 20,000 – 40 000 ng / ml

Stain 1 cm2 in area

~200 ng

Stain in 1 mm2 area

~2 ng

Semen Postcoital vaginal swab

150, 000 – 300, 000 ng / ml 0 – 3, 000 ng

Hair Plucked

1 – 750 ng / hair

shed

1 –12 ng / hair

Saliva

1, 000 – 10, 000 ng / ml

Urine

1 – 20 ng / ml

Fig. 8 DNA content in biological sample

Chance occurrence of band matching Number of Bands

Odds againstachancematch

4

250 to 1

6

4000 to 1

8

65000 to 1

10

1 million to 1

12

17 million to 1

14

268 million to 1

16

4300 million to 1

18

68000 million to 1

20

1 million million to 1

Fig. 9 The chance occurrence of Band matching

Settling paternity disputes •

every child must inherit one copy of a pair of homologous chromosome from each parent

Mother

Father

Genetic disorder and its diagnosis • due to mutation

Sickle cell anaemia

Haemophilia