Metabolism Discussion Paper

A R T I C L E

Identification of SH2-B as a key regulator of leptin sensitivity, energy balance, and body weight in mice Decheng Ren, Minghua Li, Chaojun Duan, and Liangyou Rui* Department of Molecular and Integrative Physiology, University of Michigan Medical School, Ann Arbor, Michigan 48109 *Correspondence: [email protected]

Summary Leptin regulates energy balance and body weight by activating its receptor LEPRb and multiple downstream signaling pathways, including the STAT3 and the IRS2/PI 3-kinase pathways, in the hypothalamus. Leptin stimulates activation of LEPRb-associated JAK2, which initiates cell signaling. Here we identified SH2-B, a JAK2-interacting protein, as a key regulator of leptin sensitivity, energy balance, and body weight. SH2-B homozygous null mice were severely hyperphagic and obese and developed a metabolic syndrome characterized by hyperleptinemia, hyperinsulinemia, hyperlipidemia, hepatic steatosis, and hyperglycemia. The expression of hypothalamic orexigenic NPY and AgRP was increased in SH2-B−/− mice. Leptin-stimulated activation of hypothalamic JAK2 and phosphorylation of hypothalamic STAT3 and IRS2 were significantly impaired in SH2-B−/− mice. Moreover, overexpression of SH2-B counteracted PTP1B-mediated inhibition of leptin signaling in cultured cells. Our data suggest that SH2-B is an endogenous enhancer of leptin sensitivity and required for maintaining normal energy metabolism and body weight in mice. Introduction Body weight is determined by a balance between energy intake and energy expenditure. When energy intake exceeds energy expenditure, excessive energy is stored as triglyceride in adipose tissue, leading to overweight and obesity. The hypothalamus is a key area in the central nervous system (CNS) that controls body weight and energy homeostasis by integrating various neuronal, hormonal, and nutrient-related signals (Friedman and Halaas, 1998; Schwartz and Porte, 2005; Seeley et al., 2004). Leptin is the primary adipose-derived hormone that conveys peripheral signals of nutrient storage and availability to the hypothalamus. Genetic deficiency of either leptin or its receptor results in severe hyperphagia and morbid obesity (Chen et al., 1996; Clement et al., 1998; Lee et al., 1996; Montague et al., 1997; Tartaglia et al., 1995; Zhang et al., 1994). Obesity is associated with a metabolic syndrome characterized by hyperlipidemia, hepatic steatosis, and type 2 diabetes. Leptin receptor mRNA can be alternatively spliced to produce five different isoforms (LEPRa-e), which have the same extracellular domain but distinct cytoplastic domains of various lengths (Lee et al., 1996). LEPRb is the longest isoform and the only form that mediates cell signaling. LEPRb interacts with JAK2, a member of the JAK family of cytoplasmic tyrosine kinases. Leptin stimulates activation of JAK2, which initiates various downstream pathways, including the STAT3 and the IRS2/ phosphatidylinositol (PI) 3-kinase pathways (Carvalheira et al., 2003; Duan et al., 2004a; Kellerer et al., 1997; Kim et al., 2000; Vaisse et al., 1996). Disruption of the STAT3 pathway causes leptin resistance and morbid obesity in mice (Bates et al., 2003; Cui et al., 2004; Gao et al., 2004). Similarly, inhibition of the IRS2/PI 3-kinase pathway also induces leptin resistance and obesity (Lin et al., 2004; Niswender et al., 2001; Suzuki et al., 2004; Zhao et al., 2002). These observations suggest that both

the STAT3 and the IRS2/PI 3-kinase pathways are required for leptin regulation of energy homeostasis. SH2-B is a ubiquitously expressed cytoplasmic protein that contains a pleckstrin homology (PH) and a Src-homology-2 (SH2) domain and multiple phosphorylation sites (Rui et al., 1997). In cultured cells, SH2-B binds to JAK2 via its SH2 domain, resulting in potentiation of JAK2 activation in response to growth hormone (Rui and Carter-Su, 1999). SH2-B also binds via its SH2 domain to multiple receptor tyrosine kinases including receptors for insulin, insulin-like growth factor-1, platelet-derived growth factor, fibroblast growth factor, and nerve growth factor (NGF) (Kong et al., 2002; Kotani et al., 1998; Qian et al., 1998; Riedel et al., 1997; Rui and Carter-Su, 1998; Rui et al., 1997, 1999). Our recent studies demonstrate that SH2-B binds simultaneously to both JAK2 and IRS2, promoting leptin-stimulated activation of the PI 3-kinase pathway in cultured cells (Duan et al., 2004a). To investigate the physiological role of SH2-B, we and another group have independently generated SH2-B-deficient mice by homologous recombination (Duan et al., 2004b; Ohtsuka et al., 2002). We previously reported that SH2-B deficient mice develop insulin resistance and type 2 diabetes (Duan et al., 2004b). Ohtsuka et al. reported an essential role of SH2-B in reproduction (Ohtsuka et al., 2002). Because SH2-B enhances JAK2 activation in cultured cells and JAK2 activation is a rate-limiting step in leptin signaling, SH2-B may regulate energy homeostasis by modulating leptin sensitivity in animals. In this work, we demonstrated that genetic deletion of the SH2-B gene resulted in severe leptin resistance, hyperphagia, and obesity. Deletion of SH2-B significantly impaired leptin-stimulated activation of JAK2 and JAK2-mediated signaling pathways in the hypothalamus. Thus, SH2-B is a key cytoplasmic signaling molecule that positively regulates leptin sensitivity in hypothalamic neurons.

CELL METABOLISM : AUGUST 2005 · VOL. 2 · COPYRIGHT © 2005 ELSEVIER INC.

DOI 10.1016/j.cmet.2005.07.004

95

A R T I C L E

Figure 1. Disruption of the SH2-B gene results in obesity A) Representative female SH2-B−/− and wild-type littermate (3 months) in both 129Sv/C57BL/6 mixed and C57BL/6 genetic backgrounds. B) Growth curves of both male (wt: n = 8; KO: n = 10) and female mice (wt: n = 8; KO: n = 8). C) The mass of epididymal (Epi), inguinal (Ing), and perirenal (Per) fat depots of males (24 weeks; wt: n = 6; KO: n = 8) and females (24 weeks; wt: n = 8; KO: n = 8). D) Whole-body fat content in male mice (18–19 weeks; wt: n = 8; KO: n = 7). E) Hematoxylin and eosin staining of inguinal fat from female mice (3 months). *p < 0.05; **p < 0.01.

Results SH2-B−/− mice develop obesity and metabolic syndrome SH2-B binds to and activates JAK2 when overexpressed in cultured cells (Rui and Carter-Su, 1999; Rui et al., 1997). JAK2 mediates cell signaling in response to a variety of hormones and cytokines including leptin, growth hormone, prolactin, and erythropoitin. To determine whether SH2-B is involved in leptin regulation of body weight, SH2-B−/− mice were generated by homologous recombination as we previously described (Duan et al., 2004b). Mice were fed normal mouse chow, and postnatal growth was monitored over a period of 27 weeks. Both male and female SH2-B−/− mice in both 129Sv/C57BL/6 mixed and C57BL/6 genetic backgrounds were markedly obese (Figures 1A–1B). SH2-B−/− homozygotes (all mice used in the following experiments were in 129Sv/C57BL/6 mixed genetic background) were born slightly smaller and gained less body weight during the first 5 weeks of postnatal growth. They then gained body weight rapidly and exceeded wild-type littermates (Figure 1B). SH2-B−/− males (21 weeks) were approximately two times heavier than wild-type littermates (wt: 28.4 ± 1.1 g, n = 8; KO: 55.9 ± 1.2 g, n = 7). Similarly, SH2-B−/− females (25 weeks) were more than 1.7 times heavier than wild-type littermates (wt: 27.3 ± 1.6 g, n = 8; KO: 47.6 ± 3.1 g, n = 7). Interestingly, body length (nose to anus) was similar between

96

SH2-B−/− mice and wild-type littermates (17–19 weeks; wt males: 9.30 ± 0.08 cm, n = 10; KO males: 9.37 ± 0.16 cm, n = 7), suggesting that SH2-B is not required for growth-hormonemediated linear growth. To determine whether the excessive body weight is caused by an increase in adiposity in SH2-B−/− mice, the mass of individual fat depots and total fat content were measured. Inguinal fat mass was increased by 4.4- and 5.1-fold in SH2-B−/− females and males, respectively (Figure 1C). Epididymal and perirenal fat masses were increased by 2.7-fold and 2.9-fold in SH2-B−/− mice, respectively (Figure 1C). Whole-body fat content, as measured by dual energy X-ray absorptiometry, was increased by more than 2.8-fold in SH2-B−/− males at 18–19 weeks of age (Figure 1D). Moreover, increased adiposity was primarily caused by adipose hypertrophy, with an increase of average adipose diameter by more than four times in female inguinal fat depots (Figure 1E). SH2B−/+ heterozygous mice were relatively normal in body weight when fed standard mouse chow but developed obesity when fed a high-fat diet (data not shown). Obesity is commonly associated with hyperlipidemia and type 2 diabetes. To determine whether deletion of SH2-B impairs lipid metabolism, we measured free fatty acids (FAA) and triglyceride (TG) levels in multiple tissues. Plasma FAA increased by 1.8-fold in male and 1.7-fold in female SH2-B−/− mice, while plasma TG content was elevated by 2.2-fold in

CELL METABOLISM : AUGUST 2005

SH2-B regulation of body weight

Figure 2. SH2-B−/− mice develop a metabolic syndrome A) Levels of plasma-free fatty acids (FFA) and triglycerides (TG) in randomly fed male (18 weeks; KO: n = 7; wt: n = 8) and female mice (24 weeks; wt: n = 8; KO: n = 8). B) (Left panel) Liver weight of male mice (24 weeks; wt: n = 8; KO: n = 6). (Right panel) Representative hematoxylin and eosin staining of hepatic sections from female mice (24 weeks). C) TG content in skeletal muscle of male (24 weeks; wt: n = 8; KO: n = 8) and female mice (24 weeks; wt: n = 8; KO: n = 7). TG content was normalized to muscle weight. D) Total carcass TG content. E) Fasted and randomly fed blood glucose and insulin in male mice (19–20 weeks; wt: n = 10; KO: n = 8). *p < 0.05; **p < 0.01.

male and 1.5-fold in female SH2-B−/− mice (Figure 2A). Liver mass was increased by 2.3 times in SH2-B−/− mice owing to a massive accumulation of lipids (hepatic steatosis) (Figure 2B). TG content in skeletal muscle was also significantly elevated by 2.2-fold in male and 1.7-fold in female SH2-B−/− mice (Figure 2C). Consistent with obesity and hyperlipidemia, carcass analysis revealed that total body TG content was increased by w2.7 and w2.8 times for SH2-B−/− males and females, respectively (Figure 2D). To determine whether deletion of SH2-B impairs glucose metabolism, the levels of plasma insulin and glucose were measured. SH2-B−/− mice have severe hyperglycemia and hyperinsulinemia (Figure 2E). SH2-B−/− males progressively developed severe glucose intolerance, insulin resistance, and type 2 diabetes (data not shown), consistent with our previous report (Duan et al., 2004b). Deletion of the SH2-B gene results in energy imbalance Body weight is controlled by a balance between energy intake and expenditure. Leptin decreases energy intake and increases energy expenditure, thus promoting weight loss. To determine whether SH2-B−/− mice are hyperphagic, food intake was monitored over a period of 24 weeks in individually housed mice. SH2-B−/− males consumed significantly more food than wildtype littermates after 7 weeks of age (Figure 3A). Energy intake increased more than 1.8 times in SH2-B−/− males compared to wild-type littermates at 13 weeks of age. SH2-B−/− females were also extremely hyperphagic (data not shown). Interest-

CELL METABOLISM : AUGUST 2005

ingly, the onset of hyperphagia was correlated with the onset of obesity, suggesting that elevated energy intake may be a primary cause of obesity in SH2-B−/− mice (Figures 1B and 3A). To determine whether SH2-B is involved in regulation of energy expenditure, O2 consumption and CO2/heat production were measured by indirect calorimetry in SH2-B−/− and wildtype littermates (17–19 weeks). Surprisingly, SH2-B−/− males consumed much more O2 and generated more CO2 and heat during both dark and light phases (Figures 3B–3D). O2 consumption and CO2 production were increased by 58% and 60% in the light phase, and 36% and 32% in the dark phase in SH2-B−/− males (Figure 3E). Heat production was increased by 50% in the light phase and 48% in the dark phase in SH2B−/− males (Figure 3E). When energy balance was evaluated by subtracting caloric expenditure as heat (wt: 7.60 ± 0.04 kcal/ mouse/day, n = 8; KO: 11.20 ± 0.06 kcal/mouse/day, n = 8) from total caloric intake (wt: 16.80 ± 1.70 kcal/mouse/day, n = 8; KO: 26.20 ± 6.30 kcal/mouse/day, n = 8), SH2-B−/− male mice had a positive energy imbalance 63% higher than wildtype control mice at 18–19 weeks of age. SH2-B−/− females also consumed significantly more O2 and generated more CO2 and heat (data not shown). These results demonstrate that the energy expenditure is significantly higher in SH2-B−/− mice than wild-type littermates; however, SH2-B−/− mice remain in a state of positive energy imbalance and become obese, primarily due to extreme hyperphagia. To verify elevated energy expenditure in SH2-B−/− mice, both SH2-B−/− males and wild-type littermates were housed individ-

97

A R T I C L E

Figure 3. Disruption of the SH2-B gene results in energy imbalance A) Average food intake (kcal/mouse/day) in male mice (wt: n = 8; KO: n = 8). Mice were housed individually, and food intake was monitored over a period of 24 weeks. B–D) O2 consumption (B) and the production of CO2 (C) and heat (D) in randomly fed male mice (17–19 weeks; wt: n = 8; KO: n = 7). The values were normalized to lean body mass. E) Average values from (B)–(D). F) Body weight in pair-fed male mice (wt: n = 7; KO: n = 7). Mice were housed individually. Each mouse was fed daily (9:00 a.m.) with the same amount of normal mouse chow. *p < 0.05; **p < 0.01.

ually and pair fed for 15 weeks. Under this paradigm, SH2B−/− mice gained significantly less body weight than wild-type littermates (Figure 3F). The reduction of weight gain is most likely caused by elevated energy expenditure in SH2-B−/− mice. These data raise a possibility that energy intake and expenditure may be controlled by two distinct neuronal pathways that may be differentially regulated by SH2-B. SH2-B−/− mice develop severe leptin resistance Leptin resistance is a primary risk factor for obesity. To determine whether deletion of SH2-B leads to leptin resistance, plasma leptin levels were measured in SH2-B−/− mice. Both male and female SH2-B−/− mice developed severe hyperleptinemia, a hallmark of leptin resistance. Fasted and randomly fed plasma leptin levels were 3.2 times and 5.1 times higher in SH2-B−/− males than wild-type littermates at 15 weeks of age (7–8 weeks after the onset of hyperphagia and obesity), respectively (Figure 4A). Similarly, randomly fed plasma leptin levels were 6.4 times higher in SH2-B−/− females than wildtype littermates at 26 weeks of age (Figure 4A). To determine whether leptin resistance precedes the onset of obesity, body composition and plasma leptin were measured in young SH2B−/− mice (6–7 weeks) prior to the onset of obesity. Although total fat content was similar between SH2-B−/− and wild-type littermates, plasma leptin levels were elevated by 67% in SH2B−/− mice (Figure 4B). These data suggest that leptin resistance

98

may be a cause, rather than a consequence, of obesity in SH2B−/− mice. To determine whether deletion of SH2-B impairs the ability of leptin to reduce food intake and weight gain, mouse leptin (2 mg/kg body weight) or PBS (as control) was injected intra-

Figure 4. Disruption of the SH2-B gene induces hyperleptinemia A) Plasma leptin levels in male (15 weeks; wt: n = 8; KO: n = 7) and female mice (26 weeks; wt: n = 8; KO: n = 7). B) Fat content and randomly fed plasma leptin in young male mice (6–7 weeks; wt: n = 9; KO: n = 8). *p < 0.05; **p < 0.01.

CELL METABOLISM : AUGUST 2005

SH2-B regulation of body weight

Figure 6. Disruption of the SH2-B gene increases the expression of hypothalamic NPY and AgRP

Figure 5. Deletion of SH2-B attenuates leptin-induced inhibition of food intake and weight gain Mice (7 weeks; wt: n = 4; KO: n = 4) were housed individually and injected intraperitoneally with leptin (2 mg/kg body weight) or PBS (as control) twice a day (6:00 p.m. and 12:00 a.m.) for 2 days (indicated by two arrows). Food intake and body weight were monitored both before and after the injection. Changes in food intake and body weight were calculated as a percentage of the initial values prior to the injection.

peritoneally into SH2-B−/− mice at 7 weeks of age, and food intake and body weight were monitored. Leptin significantly reduced both food intake and weight gain in wild-type animals compared with PBS. In contrast, leptin was unable to reduce either food intake or weight gain in SH2-B−/− mice (Figure 5). Together, these results demonstrate that deletion of SH2-B causes severe leptin resistance, which may contribute to obesity in SH2-B−/− mice. Disruption of the SH2-B gene alters hypothalamic neuropeptide expression The arcuate nucleus (ARC) in the hypothalamus contains two distinct populations of leptin-responsive neurons, which coexpress either orexigenic neuropeptide Y (NPY) and agoutirelated protein (AgRP) or anorexigenic proopriomelanocortin (POMC) and cocaine- and amphetamine-regulated transcript (CART) neuropeptides. NPY and AgRP promote energy intake, whereas α-melanocyte-stimulating hormone (αMSH), a proteolytic product of POMC, decreases energy intake and body weight (Friedman and Halaas, 1998; Schwartz and Porte, 2005; Seeley et al., 2004). Leptin decreases the expression of orexigenic NPY and AgRP and increases the expression of anorexigenic POMC (Elias et al., 1998; Flier, 2004; Kristensen et al., 1998; Schwartz et al., 1996; Schwartz et al., 1997). NPY, AgRP, and αMSH may act downstream of leptin receptor to mediate leptin regulation of feeding and body weight. To determine whether these neuropeptides are involved in the development of hyperphagia and obesity in SH2-B−/− mice, the expression of hypothalamic POMC, NPY, and AgRP was measured in mice fasted for 8 hr (from 9:00 a.m. to 5:00 p.m.). Total hypothalamic RNA was extracted, and POMC, NPY, and AgRP mRNA abun-

CELL METABOLISM : AUGUST 2005

Males (12–14 weeks; wt: n = 7; KO: n = 7) or females (16 weeks; wt: n=6; KO: n=13) were fasted for 8 hr (from 9:00 a.m. through 5:00 p.m.) and sacrificed by decapitation. Total hypothalamic RNA was prepared, and NPY, AgRP, POMC, and β-actin mRNA were measured using quantitative real-time PCR analysis. The expression of NPY, AgRP, and POMC was normalized to the expression of β-actin. *p < 0.05.

dance was measured by quantitative real-time PCR assays and normalized to hypothalamic β-actin mRNA abundance. Hypothalamic NPY and AgRP mRNA was elevated by 2 and 2.4 times, respectively, in SH2-B−/− males (Figure 6). The expression of orexigenic NPY and AgRP was also significantly increased in SH2-B−/− females (Figure 6). In contrast, the levels of anorexigenic POMC were similar between SH2-B−/− and wild-type littermates (Figure 6). Because plasma leptin levels were dramatically elevated in SH2-B−/− mice, hypothalamic POMC neurons may also be leptin resistant, but to a lesser extent than hypothalamic NPY/AgRP neurons in SH2-B−/− mice. These data suggest that deletion of SH2-B may severely impair leptin sensitivity in hypothalamic NPY/AgRP neurons, resulting in a significant increase in the expression of NPY and AgRP. The elevation of hypothalamic NPY and/or AgRP may contribute to hyperphagia and obesity in SH2-B−/− mice. The expression of hypothalamic LEPRb and SOCS3 was similar between SH2-B−/− mice and wild-type littermates (data not shown), suggesting that leptin resistance and obesity may not be caused by an altered expression of these two proteins in SH2-B−/− mice. Disruption of the SH2-B gene impairs leptin signaling in the hypothalamus Since overexpressed SH2-B binds to and activates JAK2 in cultured cells, SH2-B may increase leptin sensitivity by enhancing leptin-stimulated JAK2 activation in the hypothalamus. To determine whether SH2-B is expressed in leptin target tissues, hypothalami were isolated from SH2-B−/− mice and wildtype littermates at 6 weeks of age and homogenized in lysis buffer. Hypothalamic SH2-B was immunoprecipitated with αSH2-B and immunoblotted with αSH2-B. Two forms of SH2-B were detected in the hypothalamus (Figure 7A). Treatment with alkaline phosphatase failed to alter the migration of these two forms, suggesting that they represent two distinct isoforms of SH2-B rather than differential phosphorylation states (data not

99

A R T I C L E

Figure 7. Disruption of the SH2-B gene attenuates leptin-stimulated JAK2 activation and tyrosine phosphorylation of STAT3 and IRS2 A) Hypothalamic extracts were prepared from wild-type and SH2-B−/− males (6 weeks), immunoprecipitated with αSH2-B, and immunoblotted with αSH2-B. B) JAK2 in the ARC extracts was immunoprecipitated with αJAK2 and subjected to an in vitro kinase assay (top panel). The JAK2 protein levels were estimated by immunoblotting with αJAK2 (bottom panel). Each lane represents hypothalamic JAK2 from two mice (7 weeks). C) Hypothalamic extracts were prepared from leptin- (wt: n = 8; KO: n = 8) or PBS-treated mice (wt: n = 5; KO: n = 5) and immunoblotted with αphospho-STAT3. STAT3 phosphorylation was normalized to total hypothalamic STAT3 protein. D) Hypothalamic extracts were prepared from leptin- (wt: n = 8; KO: n = 8) or PBS-treated mice (wt: n = 5; KO: n = 5), immunoprecipitated with αIRS2, and immunoblotted with anti-phospho-tyrosine. IRS2 phosphorylation was normalized to total hypothalamic IRS2 protein. E) STAT3 was transiently coexpressed in HEK293LEPRb cells with PTP1B and Myc-tagged SH2-Bβ as indicated. Cells were treated with leptin (100 ng/ml) for various times, and cell extracts were immunoblotted with αphospho-STAT3, αSTAT3, αPTP1B, or αMyc as indicated. *p < 0.05; **p < 0.01.

shown). SH2-B mRNA produces at least four isoforms (α, β, γ, and δ) via alternative splicing (Nelms et al., 1999; Yousaf et al., 2001). To determine whether SH2-B enhances leptin-stimulated JAK2 activation in the hypothalamus, JAK2 tyrosine kinase activity was measured in SH2-B−/− mice and wild-type littermates at 7–8 weeks of age. Mice were fasted for 24 hr and injected intraperitoneally with leptin (1 mg/kg body weight) or PBS, and the ARC of the hypothalamus was isolated 30 min after injection. JAK2 was immunoprecipitated with αJAK2 and subjected to an in vitro kinase assay in the presence of [γ-32P]-ATP. Leptin stimulated JAK2 activation in the ARC in wild-type mice as expected, whereas leptin-stimulated JAK2 activation was significantly reduced in SH2-B−/− male mice (Figure 7B). To determine whether deletion of SH2-B impairs JAK2-mediated pathways in the hypothalamus, leptin-stimulated tyrosine phosphorylation of STAT3 and IRS2 was measured in SH2-B−/− mice and wild-type littermates. JAK2 phosphorylates STAT3 at Tyr705 in response to leptin, which is required for STAT3 activa-

100

tion. Fasted mice were injected intraperitoneally with leptin or PBS, and hypothalamic extracts were prepared and immunoblotted with an anti-phospho-STAT3 (pTyr705) antibody. Leptin stimulated STAT3 phosphorylation in wild-type mice as expected. In contrast, leptin-stimulated STAT3 phosphorylation was significantly reduced in SH2-B−/− mice (Figure 7C). To examine leptin-stimulated tyrosine phosphoryation of IRS2, fasted mice were injected intraperitoneally with leptin or PBS, and the hypothalamus was isolated. Two hypothalami were pooled and homogenized in lysis buffer. IRS2 was immunoprecipitated with αIRS2 and immunoblotted with αPY. Leptin stimulated tyrosine phosphorylation of IRS2 in wild-type mice; in contrast, leptin failed to stimulate IRS2 phosphorylation in SH2-B−/− mice (Figure 7D). Together, these results demonstrate that deletion of SH2-B impairs leptin signaling in the hypothalamus, which may contribute to leptin resistance and obesity in SH2-B−/− mice. Leptin signaling is negatively regulated by PTP1B, a protein tyrosine phosphatase that binds to and dephosphorylates

CELL METABOLISM : AUGUST 2005

SH2-B regulation of body weight

JAK2 (Kaszubska et al., 2002; Myers et al., 2001). Genetic deletion of the PTP1B gene improves leptin sensitivity and protects against high-fat-diet-induced obesity (Cheng et al., 2002; Zabolotny et al., 2002). To determine whether SH2-B counteracts PTP1B-mediated inhibition of leptin signaling, SH2-B and PTP1B were transiently coexpressed in HEK293LEPRb cells that stably express the leptin receptor LEPRb (Duan et al., 2004a). Leptin-stimulated activation of STAT3 was examined by immunoblotting cell extracts with anti-phospho-STAT3 (pTyr705) antibody. Leptin stimulated STAT3 phosphorylation, which was inhibited by PTP1B as expected (Figure 7E). SH2-B rescued the inhibition of STAT3 phosphorylation induced by PTP1B (Figure 7E). These results demonstrate that SH2-B is able to enhance leptin signaling by counteracting the inhibitory effects of negative regulators, including PTP1B. Discussion SH2-B is widely expressed in multiple tissues, including the brain, skeletal muscle, adipose tissue, and the liver, suggesting that this molecule may have pleiotropic function in animals. Consistent with this idea, SH2-B binds via its SH2 domain to both the cytoplasmic tyrosine kinase JAK2 and multiple receptor tyrosine kinases, mediating cell signaling in response to multiple hormones, growth factors, and cytokines in cultured cells. In animals, SH2-B is required for reproduction, presumably by mediating insulin-like growth factor I action in gonadal tissues (Ohtsuka et al., 2002). We reported recently that SH2-B is required for insulin regulation of glucose homeostasis in mice (Duan et al., 2004b). In the current work, we demonstrated that SH2-B is required for energy homeostasis. Genetic deletion of the SH2-B gene resulted in hyperphagia and obesity. SH2-B homozygous null mice developed a metabolic syndrome (hyperlipidemia, hyperglycemia, hyperleptinemia and hyperinsulinemia, and hepatic steatosis), which is commonly associated with obesity. SH2-B enhances leptin-stimulated activation of the PI 3-kinase pathway by recruiting IRS proteins to JAK2 in cultured cells (Duan et al., 2004a). In addition, overexpression of SH2-B potentiates JAK2 activation (Rui and Carter-Su, 1999). Consistent with these observations, we found that deletion of SH2-B impaired leptin-stimulated JAK2 activation and tyrosine phosphorylation of both STAT3 and IRS2 in the hypothalamus. Since both the STAT3 and the IRS2/PI 3-kinase pathways are required for leptin regulation of feeding and body weight, attenuation of the STAT3 and/or IRS2/PI 3-kinase pathways may contribute to reduced ability of leptin to inhibit food intake and weight gain in SH2-B−/− mice. Interestingly, overexpression of SH2-B counteracted PTP1B-mediated inhibition of leptin signaling, raising a possibility that leptin sensitivity may be modulated by a balance between positive (e.g., SH2-B) and negative regulators (e.g., SOCS3, PTP1B) in the hypothalamus. SH2-Bdeficient mice developed severe leptin resistance, and hyperleptinemia preceded the onset of obesity, suggesting that leptin resistance may contribute to hyperphagia and obesity in SH2-B−/− mice. Leptin resistance is associated with increased energy intake and reduced energy expenditure in most animal models of obesity. Surprisingly, deletion of SH2-B increased both energy intake and energy expenditure; however, energy intake still exceeded energy expenditure, resulting in obesity. One possible

CELL METABOLISM : AUGUST 2005

explanation is that SH2-B expression and/or its ability to enhance leptin signaling may be different between neurons controlling energy intake and neurons controlling energy expenditure. Deletion of SH2-B may severely impair leptin signaling in neurons regulating energy intake, resulting in hyperphagia. In contrast, SH2-B deficiency may only mildly impair leptin sensitivity in neurons regulating energy expenditure. Severe hyperleptinemia may overcome mild leptin resistance in these neurons, resulting in elevated energy expenditure in SH2-B−/− mice. Consistent with this idea, deletion of SH2-B severely impaired leptin sensitivity in the NPY/AgRP neurons in the hypothalamus, resulting in a significant increase in the expression of orexigenic NPY and AgRP, even in the presence of severe hyperleptinemia. In contrast, the expression of anorexigenic POMC was similarly between SH2-B−/− and wild-type littermates. Since SH2-B is involved in cell signaling in response to multiple hormones, growth factors, and cytokines, SH2-B deficiency may additionally alter physiological actions of some of these ligands, which may also contribute to energy imbalance and obesity in SH2-B−/− mice. SH2-B−/− mice developed hyperinsulinemia, hyperglycemia, and glucose intolerance. SH2-B directly binds to the insulin receptor, enhancing insulin-stimulated activation of the insulin receptor and downstream pathways (Ahmed and Pillay, 2003; Duan et al., 2004b; Kotani et al., 1998; Riedel et al., 1997; Wang and Riedel, 1998). Deletion of SH2-B may directly impair insulin sensitivity in the liver, skeletal muscle, and/or adipose tissue, contributing to insulin resistance (Duan et al., 2004b). Obesity may further exacerbate insulin resistance, resulting in type 2 diabetes in SH2-B−/− mice. Ohtsuka et al. reported that SH2-B−/− mice have growth retardation and reduced body weight at 2–6 weeks of age, then grow faster than wild-type mice and have similar body weights as wild-type mice at 10 weeks of age (Ohtsuka et al., 2002). We also observed growth retardation in young SH2-B−/− mice; however, we demonstrated that SH2-B−/− mice progressively develop obesity after 7 weeks of age. The expression of AgRP was significantly increased in SH2-B−/− mice, which may inhibit the melanocortin system in the hypothalamus. Inhibition of the melanocortin system increases the sensitivity to stress and stress-induced weight loss and reduction of food intake (De Souza et al., 2000; Harris et al., 2001; Vergoni et al., 1999). SH2-B−/− mice may be more sensitive to environmental stress, potentially perturbing their energy homeostasis. The difference in diets and environmental stress may explain the discrepancy between our results and the observations reported by Ohtsuka and coworkers. In summary, we demonstrate that disruption of the SH2-B gene resulted in severe leptin resistance, hyperphagia, obesity, and obesity-associated metabolic syndrome. Leptin signaling was significantly impaired in the hypothalamus in SH2-B−/− mice. Moreover, SH2-B directly counteracted PTP1B-induced inhibition of leptin signaling in cultured cells. These observations raise a possibility that SH2-B and SH2-B-regulated signaling events may serve as potential therapeutic targets for a treatment of obesity and type 2 diabetes. Experimental procedures Animal experiments SH2-B knockout mice (in 129Sv/C57BL/6 genetic background) were generated by homologous recombination as described previously (Duan et al.,

101

A R T I C L E

2004b). SH2-B+/− males were backcrossed with wild-type C57BL/6 females (Jackson Laboratory, Bar Harbor, Maine) for seven generations to obtain SH2-B knockout mice in a C57BL/6 background. Mice were housed on a 12 hr/12 hr light/dark cycle in the Unit for Laboratory Animal Medicine (ULAM) at the University of Michigan, with free access to water and standard mouse chow (9% fat content). Animal experiments were conducted following the protocols approved by the University Committee on the Use and Care of Animals (UCUCA). Blood samples were collected from the tail vein and assayed for plasma insulin and leptin using rat insulin or mouse leptin ELISA kits (Crystal Chem Inc., Chicago, Illinois), respectively. Free fatty acids and TG were measured using Wako NEFAC (Wako Chemicals USA, Inc., Richmond, Virginia) and Free Glycerol Reagent (Sigma, St. Louis, Missouri), respectively. For histological analysis, liver or adipose tissues were isolated and fixed in Bouins solution (Sigma, St. Louis, Missouri). Paraffin sections were prepared and stained with hematoxylin and eosin. Images were visualized using BX51 Microscope (Olympus, Tokyo, Japan), and captured using a DP70 microscope digital camera (Olympus, Tokyo, Japan). To examine leptin inhibition of food intake and weight gain, SH2-B−/− mice and wild-type littermates were housed individually with free access to food and water. Mice were injected with leptin (2 mg/kg body weight) or PBS (as control) twice daily (6:00 p.m. and 12:00 a.m.) for 2 days. Food intake and body weight were monitored both before and after leptin injection. To measure tissue TG, tissue was homogenized in chloroform:methanol (2:1) and incubated at room temperature for 4 hr. Tissue extracts were air dried, resuspended in KOH (3 M), incubated at 70°C for 1 hr, neutralized with MgCl2, and subjected to a TG assay as described above. To measure total-body TG, animals were sacrificed, and the gastrointestinal track and head were removed. Carcasses were incubated in alcoholic KOH at room temperature for 4 weeks. The extracts were neutralized with MgCl2 and subjected to a TG assay. Measurements of energy expenditure Metabolic rates were measured by indirect calorimetry (Windows Oxymax Equal Flow System, Columbus Instruments, Columbus, Ohio) in 17- to 19week-old mice. Mice were housed individually in air-tight respiratory cages through which room air was passed at a flow rate of 0.5 liters/min. Exhaust air was sampled at 27 min intervals for a period of 1 min; O2 and CO2 content of the exhaust was determined by comparison to O2 and CO2 content of standardized sample air. Mice were acclimatized to the cages for 48 hr before measurements. Lean body mass and fat content were determined using a dual-energy X-ray absorptiometry method (Dexa, Sabre Bone Densitormetry, Norland Med). VO2, VCO2, and heat production were normalized to lean body mass. Quantitative real-time PCR analysis Mice were fasted for 8 hr (from 9:00 a.m. through 5:00 p.m.) and sacrificed by decapitation. The hypothalamus was isolated immediately, and total hypothalamic RNA was prepared using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, California). The first-strand cDNAs were synthesized using oligo dT (12–18) and M-MLV reverse transcriptase (Promega, Madison, Wisconsin). NPY, POMC, AgRP, and β-actin mRNAs were measured using the Brilliant SYBR Green QPCR kit and Mx3000P real-time PCR system (Stratagene, La Jolla, California). The expression of NPY, AgRP, and POMC was normalized to the expression of β-actin. Primers for real time RT-PCR were the following: NPY sense 5#-TCAGACCTCTTAATGAAGG AAAGCA-3#, NPY antisense 5#-GAGAACAAGTTTCATTTCCCATCA-3#; AgRP sense 5#- GGCCTCAAGAAGACAACTGC, AgRP antisense 5#- GACTCGT GCAGCCTTACACA-3#; POMC sense 5#-CTGCTTCAGACCTCCATAGAT GTG-3, POMC antisense CAGCGAGAGGTCGAGTTTGC; β-actin sense 5#AAATCGTGCGTGACATCAAA-3#, β-actin antisense 5#- AAGGAAGGCTGG AAAAGAGC. JAK2 in vitro kinase assay SH2-B−/− mice and wild-type littermates (7 weeks) were fasted for 24 hr and injected intraperitoneally with leptin (1 mg/kg body weight) or PBS (as control). Thirty minutes later, the brain was removed and placed in a cooled mouse brain matrix with 1 mm section dividers (ASI Instruments Inc., Warren, Michigan). The brain was cut sagittally to separate the two hemi-

102

spheres. Two additional sagittal cuts produced two 1 mm thick sagittal sections to the left and right of the third ventricle. Landmarks (the fornix, optic tracts, and mammillary nuclei) were used to dissect ARC enriched tissues. The two tissue pieces from each brain region were combined. ARC was combined from two mice treated identically, and homogenized in lysis buffer (50 mM Tris-HCl [pH 7.5], 5 mM EDTA, 10 mM Na4P2O7, 100 mM NaF, 250 mM sucrose, 1% NP40). JAK2 was immunoprecipitated with αJAK2 and washed with kinase buffer (50 mM HEPES [pH 7.6], 10 mM MnCl2, 0.5 mM DTT, 100 mM NaCl, 1 mM Na3VO4). Immunopurified JAK2 was incubated in the kinase buffer containing 20 uM cold ATP, 300 uCi [γ-32P]-ATP/ml; resolved by SDS-PAGE; and visualized by autoradiography as we described previously (Rui and Carter-Su, 1999). Immunoprecipitation and immunoblotting SH2-B−/− mice and wild-type littermates (7 weeks) were fasted for 24 hr and injected intraperitoneally with leptin (1 mg/kg body weight) or PBS (as control). Forty-five minutes later, mice were sacrificed by decapitation, and the hypothalamus was isolated and homogenized in lysis buffer as described above. The same amount of protein in hypothalamic extracts were immunoblotted with anti-phospho-STAT3 (pTyr705) antibody (Santa Cruz, California). The same blots were reprobed with anti-STAT3 antibody (Santa Cruz, California) to estimate total STAT3 protein. In parallel experiments, hypothalamic extracts were immunoprecipitated with αIRS2 and immunoblotted with anti-phosphotyrosine antibody (PY20) (Upstate Biotechnology Inc., Lake Placid, New York). The same blots were reprobed with αIRS2 to estimate total IRS2 protein. Transfection HEK293LEPRb cells were split at 2 × 105 cells per well in 6-well culture dishes 24 hr before transfection and transfected with indicated plasmids using Lipofectamine 2000 reagents according to the manufacturer’s instruction. Cells were deprived of serum overnight 24 hr after transfection and then treated with 100 ng/ml mouse leptin for the indicated time. Cell extracts were prepared and subjected to immunoblotting with indicated antibody. Statistical analysis The data are presented as the mean ± SEM. Student’s t tests were used for comparisons beteween two groups. P < 0.05 was considered statistically significant. Acknowledgments We thank David Morris and Drs. Zhiqin Li, Michael Wang and John Williams for helpful discussion. We thank Dr. Kun-liang Guan for providing PTP1B cDNA. This study was supported by Career Development Award (7-03-CD11) from the American Diabetes Association and RO1 DK 065122 from NIH (both to L.R.). This work utilized the cores supported by the Michigan Diabetes Research and Training Center (funded by NIH 5P60 DK20572), University of Michigan’s Cancer Center (funded by NIH 5 P30 CA46592), and University of Michigan Center for Integrative Genomics.

Received: February 9, 2005 Revised: May 17, 2005 Accepted: July 20, 2005 Published: August 16, 2005 References Ahmed, Z., and Pillay, T.S. (2003). Adapter protein with a pleckstrin homology (PH) and an Src homology 2 (SH2) domain (APS) and SH2-B enhance insulin-receptor autophosphorylation, extracellular-signal-regulated kinase and phosphoinositide 3-kinase-dependent signalling. Biochem. J. 371, 405–412. Bates, S.H., Stearns, W.H., Dundon, T.A., Schubert, M., Tso, A.W., Wang, Y., Banks, A.S., Lavery, H.J., Haq, A.K., Maratos-Flier, E., et al. (2003). STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421, 856–859. Carvalheira, J.B., Ribeiro, E.B., Folli, F., Velloso, L.A., and Saad, M.J. (2003).

CELL METABOLISM : AUGUST 2005

SH2-B regulation of body weight

Interaction between leptin and insulin signaling pathways differentially affects JAK-STAT and PI 3-kinase-mediated signaling in rat liver. Biol. Chem. 384, 151–159. Chen, H., Charlat, O., Tartaglia, L.A., Woolf, E.A., Weng, X., Ellis, S.J., Lakey, N.D., Culpepper, J., Moore, K.J., Breitbart, R.E., et al. (1996). Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84, 491–495. Cheng, A., Uetani, N., Simoncic, P.D., Chaubey, V.P., Lee-Loy, A., McGlade, C.J., Kennedy, B.P., and Tremblay, M.L. (2002). Attenuation of leptin action and regulation of obesity by protein tyrosine phosphatase 1B. Dev. Cell 2, 497–503. Clement, K., Vaisse, C., Lahlou, N., Cabrol, S., Pelloux, V., Cassuto, D., Gourmelen, M., Dina, C., Chambaz, J., Lacorte, J.M., et al. (1998). A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398–401. Cui, Y., Huang, L., Elefteriou, F., Yang, G., Shelton, J.M., Giles, J.E., Oz, O.K., Pourbahrami, T., Lu, C.Y., Richardson, J.A., et al. (2004). Essential role of STAT3 in body weight and glucose homeostasis. Mol. Cell. Biol. 24, 258–269.

Hypothalamic CART is a new anorectic peptide regulated by leptin. Nature 393, 72–76. Lee, G.H., Proenca, R., Montez, J.M., Carroll, K.M., Darvishzadeh, J.G., Lee, J.I., and Friedman, J.M. (1996). Abnormal splicing of the leptin receptor in diabetic mice. Nature 379, 632–635. Lin, X., Taguchi, A., Park, S., Kushner, J.A., Li, F., Li, Y., and White, M.F. (2004). Dysregulation of insulin receptor substrate 2 in beta cells and brain causes obesity and diabetes. J. Clin. Invest. 114, 908–916. Montague, C.T., Farooqi, I.S., Whitehead, J.P., Soos, M.A., Rau, H., Wareham, N.J., Sewter, C.P., Digby, J.E., Mohammed, S.N., Hurst, J.A., et al. (1997). Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903–908. Myers, M.P., Andersen, J.N., Cheng, A., Tremblay, M.L., Horvath, C.M., Parisien, J.-P., Salmeen, A., Barford, D., and Tonks, N.K. (2001). TYK2 and JAK2 are substrates of protein-tyrosine phosphatase 1B. J. Biol. Chem. 276, 47771–47774. Nelms, K., O’Neill, T.J., Li, S., Hubbard, S.R., Gustafson, T.A., and Paul, W.E. (1999). Alternative splicing, gene localization, and binding of SH2-B to the insulin receptor kinase domain. Mamm. Genome 10, 1160–1167.

De Souza, J., Butler, A.A., and Cone, R.D. (2000). Disproportionate inhibition of feeding in A(y) mice by certain stressors: a cautionary note. Neuroendocrinology 72, 126–132.

Niswender, K.D., Morton, G.J., Stearns, W.H., Rhodes, C.J., Myers, M.G., Jr., and Schwartz, M.W. (2001). Intracellular signalling. Key enzyme in leptininduced anorexia. Nature 413, 794–795.

Duan, C., Li, M., and Rui, L. (2004a). SH2-B promotes insulin receptor substrate 1 (IRS1)- and IRS2-mediated activation of the phosphatidylinositol 3-kinase pathway in response to leptin. J. Biol. Chem. 279, 43684–43691.

Ohtsuka, S., Takaki, S., Iseki, M., Miyoshi, K., Nakagata, N., Kataoka, Y., Yoshida, N., Takatsu, K., and Yoshimura, A. (2002). SH2-B is required for both male and female reproduction. Mol. Cell. Biol. 22, 3066–3077.

Duan, C., Yang, H., White, M.F., and Rui, L. (2004b). Disruption of the SH2-B gene causes age-dependent insulin resistance and glucose intolerance. Mol. Cell. Biol. 24, 7435–7443.

Qian, X., Riccio, A., Zhang, Y., and Ginty, D.D. (1998). Identification and characterization of novel substrates of Trk receptors in developing neurons. Neuron 21, 1017–1029.

Elias, C.F., Lee, C., Kelly, J., Aschkenasi, C., Ahima, R.S., Couceyro, P.R., Kuhar, M.J., Saper, C.B., and Elmquist, J.K. (1998). Leptin activates hypothalamic CART neurons projecting to the spinal cord. Neuron 21, 1375– 1385.

Riedel, H., Wang, J., Hansen, H., and Yousaf, N. (1997). PSM, an insulindependent, pro-rich, PH, SH2 domain containing partner of the insulin receptor. J. Biochem. (Tokyo) 122, 1105–1113.

Flier, J.S. (2004). Obesity wars: molecular progress confronts an expanding epidemic. Cell 116, 337–350.

Rui, L., and Carter-Su, C. (1998). Platelet-derived growth factor (PDGF) stimulates the association of SH2-Bbeta with PDGF receptor and phosphorylation of SH2-Bbeta. J. Biol. Chem. 273, 21239–21245.

Friedman, J.M., and Halaas, J.L. (1998). Leptin and the regulation of body weight in mammals. Nature 395, 763–770. Gao, Q., Wolfgang, M.J., Neschen, S., Morino, K., Horvath, T.L., Shulman, G.I., and Fu, X.Y. (2004). Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. Proc. Natl. Acad. Sci. USA 101, 4661–4666.

Rui, L., and Carter-Su, C. (1999). Identification of SH2-bbeta as a potent cytoplasmic activator of the tyrosine kinase Janus kinase 2. Proc. Natl. Acad. Sci. USA 96, 7172–7177. Rui, L., Mathews, L.S., Hotta, K., Gustafson, T.A., and Carter-Su, C. (1997). Identification of SH2-Bbeta as a substrate of the tyrosine kinase JAK2 involved in growth hormone signaling. Mol. Cell. Biol. 17, 6633–6644.

Harris, R.B., Zhou, J., Shi, M., Redmann, S., Mynatt, R.L., and Ryan, D.H. (2001). Overexpression of agouti protein and stress responsiveness in mice. Physiol. Behav. 73, 599–608.

Rui, L., Herrington, J., and Carter-Su, C. (1999). SH2-B is required for nerve growth factor-induced neuronal differentiation. J. Biol. Chem. 274, 10590– 10594.

Kaszubska, W., Falls, H.D., Schaefer, V.G., Haasch, D., Frost, L., Hessler, P., Kroeger, P.E., White, D.W., Jirousek, M.R., and Trevillyan, J.M. (2002). Protein tyrosine phosphatase 1B negatively regulates leptin signaling in a hypothalamic cell line. Mol. Cell. Endocrinol. 195, 109–118.

Schwartz, M.W., and Porte, D., Jr. (2005). Diabetes, obesity, and the brain. Science 307, 375–379.

Kellerer, M., Koch, M., Metzinger, E., Mushack, J., Capp, E., and Haring, H.U. (1997). Leptin activates PI-3 kinase in C2C12 myotubes via janus kinase-2 (JAK-2) and insulin receptor substrate-2 (IRS-2) dependent pathways. Diabetologia 40, 1358–1362. Kim, Y.-B., Uotani, S., Pierroz, D.D., Flier, J.S., and Kahn, B.B. (2000). In vivo administration of leptin activates signal transduction directly in insulin-sensitive tissues: overlapping but distinct pathways from insulin. Endocrinology 141, 2328–2339. Kong, M., Wang, C.S., and Donoghue, D.J. (2002). Interaction of fibroblast growth factor receptor 3 and the adapter protein SH2-B. A role in STAT5 activation. J. Biol. Chem. 277, 15962–15970. Kotani, K., Wilden, P., and Pillay, T.S. (1998). SH2-Balpha is an insulinreceptor adapter protein and substrate that interacts with the activation loop of the insulin-receptor kinase. Biochem. J. 335, 103–109. Kristensen, P., Judge, M.E., Thim, L., Ribel, U., Christjansen, K.N., Wulff, B.S., Clausen, J.T., Jensen, P.B., Madsen, O.D., Vrang, N., et al. (1998).

CELL METABOLISM : AUGUST 2005

Schwartz, M.W., Seeley, R.J., Campfield, L.A., Burn, P., and Baskin, D.G. (1996). Identification of targets of leptin action in rat hypothalamus. J. Clin. Invest. 98, 1101–1106. Schwartz, M.W., Seeley, R.J., Woods, S.C., Weigle, D.S., Campfield, L.A., Burn, P., and Baskin, D.G. (1997). Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46, 2119–2123. Seeley, R.J., Drazen, D.L., and Clegg, D.J. (2004). The critical role of the melanocortin system in the control of energy balance. Annu. Rev. Nutr. 24, 133–149. Suzuki, R., Tobe, K., Aoyama, M., Inoue, A., Sakamoto, K., Yamauchi, T., Kamon, J., Kubota, N., Terauchi, Y., Yoshimatsu, H., et al. (2004). Both insulin signaling defects in the liver and obesity contribute to insulin resistance and cause diabetes in Irs2(−/−) mice. J. Biol. Chem. 279, 25039–25049. Tartaglia, L.A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G.J., Campfield, L.A., Clark, F.T., Deeds, J., et al. (1995). Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263– 1271.

103

A R T I C L E

Vaisse, C., Halaas, J.L., Horvath, C.M., Darnell, J.E., Jr., Stoffel, M., and Friedman, J.M. (1996). Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat. Genet. 14, 95–97. Vergoni, A.V., Bertolini, A., Wikberg, J.E., and Schioth, H.B. (1999). Selective melanocortin MC4 receptor blockage reduces immobilization stressinduced anorexia in rats. Eur. J. Pharmacol. 369, 11–15. Wang, J., and Riedel, H. (1998). Insulin-like growth factor-I receptor and insulin receptor association with a Src homology-2 domain-containing putative adapter. J. Biol. Chem. 273, 3136–3139. Yousaf, N., Deng, Y., Kang, Y., and Riedel, H. (2001). Four PSM/SH2-B alter-

104

native splice variants and their differential roles in mitogenesis. J. Biol. Chem. 276, 40940–40948. Zabolotny, J.M., Bence-Hanulec, K.K., Stricker-Krongrad, A., Haj, F., Wang, Y., Minokoshi, Y., Kim, Y.B., Elmquist, J.K., Tartaglia, L.A., Kahn, B.B., and Neel, B.G. (2002). PTP1B regulates leptin signal transduction in vivo. Dev. Cell 2, 489–495. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J.M. (1994). Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425–432. Zhao, A.Z., Huan, J.N., Gupta, S., Pal, R., and Sahu, A. (2002). A phosphatidylinositol 3-kinase phosphodiesterase 3B-cyclic AMP pathway in hypothalamic action of leptin on feeding. Nat. Neurosci. 5, 727–728.

CELL METABOLISM : AUGUST 2005