Bio Notes Chapter 10.docx

David Liao Mr. Zhang Biology Section 2 3/7/11 Section 1  Frederick Griffith o British Officer o Studied streptococcus pneumonia o Smooth = virulent; Rough = harmless  Used both strains for the experiment o Showed that DNA was the one that affected bacteria  Experiment 1: Injected R strain into mice, the Mice was unharmed  Experiment 2: Injected S strain into mice, the Mice died  Experiment 3: Injected heat killed S strain and the mice survived  Experiment 4: Injected live R strain with heat killed R strain, the mice died  Griffith proposed that this was due to Transformation o Transfer of genetic material from one cell to another cell  Oswald Avery tried to find out whether or not the thing that changed the bacteria exchanged DNA, RNA, or proteins o They used enzymes to separate the DNA, RNA and proteins o For each experiment, they followed Griffiths, but removed each factor to see which still worked o Cells without RNA and protein did not affect the mice o Cells with DNA killed the mice  Martha Chase and Hershey tested whether protein or DNA was the transferred hereditary material for viruses

o Used bacteriophages  Used radioactive Phosphorus for one experiment and used Radioactive Sulfur for another  Allowed for infection in E. Coli  Blended it to remove the phage coats  Used centrifugation to find out that most of the radioactive DNA had entered the cells Section 2  Watson & Crick o Tried to determine the structure of DNA o Made a model o Used the x-ray photographs made by Rosalind Franklin  DNA o Made of two long strands of monomers  Nucleotides  Consists of Nitrogenous Base, 5-Carbon Sugar, and a phosphate group o Similar to a spiral staircase o Bases form hydrogen bonds with each base o Every one turn = 10 base pairs o All bases are consistent in molecular structure  Exists in 4 different bases  Thymine  Guanine  Adenine  Cytosine o Purine = Adenine Guanine o Pyrimidine = Thymine Cytosine 

 

Bases pair following specific rules o Adenine makes hydrogen bonds with the complementary pair Thymine o Cytosine makes hydrogen bonds with Guanine DNA models created are usually in a ladder shape o First letter of each base pair is used in the notation o ATAATATTATCCCGCGATACGATGAGCGAGT o TATTATAATAGGGCGCTATGCTACTCGCTCT

Section 3 



DNA Replication o

Process by which DNA is copied in a cell

o

Makes 2 identical double stranded DNA

Steps of DNA Replication: o

Helicases separate DNA strands 

o

DNA polymerase then adds complementary nucleotides floating inside the nucleus

o

This is semi-conservative

 

Creates a Y shaped region called replication fork

Each of the new DNA contains one or two of the original DNA strands

DNA synthesis occurs in 2 directions o

DNA polymerase moves in one direction with the helicase on the leading strand

o

DNA polymerase moves in the opposite direction on the lagging strand 

Gaps are filled by DNA ligase



DNA Replication errors o

DNA replication is very accurate

o

It has proofreading proteins

o

Only makes mistakes every billion base pairs 

Mutations occur with the errors 

Mutations can be bad → Cancer



Mutations can be good → Genetic Variation

Section 4 

Flow of genetic Information o

DNA → RNA → Phenotype

o

Transcription 

o

DNA acts as template for RNA creation

Translation 

RNA directs the assembly of proteins 

o

Protein Synthesis or Gene Expression

RNA vs DNA 

RNA contains sugar called ribose



RNA contains nitrogenous base called Uracil



RNA is usually single stranded



RNA is shorter than DNA

o

Types of RNA 

mRNA 



rRNA 



transfers amino acids to ribosome to make proteins

Steps of Transcription 

RNA polymerase catalyzes the formation of RNA on a DNA template



A promoter is attached where RNA polymerase binds to



RNA polymerase adds free RNA nucleotides



RNA polymerase ends when it reaches a termination signal 

o

part of the structure of ribosome

tRNA 

o

carries instructions to make protein

A specific sequence of nucleotides that marks the end of a gene

Genetic Code 

Genetic code is the term for the rules that relate to how a sequence of nitrogenous bases in a nucleotide corresponds to a particular amino acid



3 nucleotides that encodes an amino acid





AUG starts



UAA UAG UGA are stop codons

Translation o

o

Protein structure 

Every protein is made by one+ polypeptides



20 different known amino acids

Steps of Translation 

Two ribosomal subunits tRNA and mRNA join together



Enzymes first attach a specific amino acid to one end of each tRNA



The tRNA contains the anticodon



Polypeptide chain is put together



The tRNA carrying the appropriate amino acid pairs is anticodon with the second codon in the mRNA 



The ribosome detaches the amino acid and forms a peptide bond with the next amino acid



Polypeptide chain grows until the ribosome reaches stop codon



The polypeptide falls off

Human Genome o

Entire sequence is around 3.2 billion base pairs

o

Analysis may help prevent disorders cancers and infectious diseases in the future

