In the Name of Allah, the Most Gracious, the Most Merciful
Miracles of Knowledge Found in The Noble Qur’an and The Teachings of Prophet Mohammad Peace Be Upon Him Dr. Zaid Kasim Mohammad Ghazzawi Website: www.quran-miracle.com
How to learn Cell Sciences from the Noble Qur’an?
The Noble Qur’an A Book which contains The Knowledge of ِ Everything The Knowledge of Creation from The Creator
The Noble Qur’an In The Name of Allah (God) Almighty The Most Gracious The Most Merciful
38. Allah (God) Almighty did not leave anything out from the Noble Qur’an, then people will be gathered to their Lord.
The knowledge of all branches of knowledge can be found in the Noble Qur’an The optimal research methodology can be found in the Noble Qur’an The terminology to describe all branches of knowledge can be found in the Noble Qur’an
In The Name of Allah (God) Almighty The Most Gracious The Most Merciful
2. A messenger from Allah (God) reciting purified pages 3. Which contain valuable books
The Noble Qur’an (98: 2-3)
Purified Pages Containing valuable books
The Noble Qur’an The books that contain the knowledge of everything
Derivation of All Cell Sciences from the Noble Qur’an
In the Name of Allah (God) Almighty The Most Gracious The Most Merciful
The Noble Qur’an (27: 88) 88. And you see the mountains and think them solid without movement, but they pass away as the passing away of the clouds. The manufacturing of Allah (God) Almighty, Who perfected all things, verily! He is Well-Acquainted with what you do.
The Mountains
A created being of Allah (God) Almighty
Allah (God) Almighty describes that it is created by a process of manufacturing
A manufacturing process needs a factory
Manufacturing process needs the following:
Factory
What are the factories in the ?creation of Allah (God) Almighty
The Cell
The cell (The factory in the creation of Allah (God) Almighty)
How is it concluded that that the cells are the factories in the creation of Allah (God) Almighty?
The product (Collagen molecule)
The factory ((The Cell
Raw materials needed for creation (Elements found in the soil)
Optimal Specifications for A Factory
That there should be a large number of factories which produce the same product:
In the case that if there is damage to a number of factories the remaining ones can produce the required products
That the product should not be harmful to the creature The optimal specifications for the structure to contain the factory:
It should have light weight It should have high stiffness and strength It should be stable
Cell structure Cell cytoskeleton
The Cell
The cell (The factory in the creation of Allah (God) Almighty)
How to know the design that satisfies the optimal ?requirements for a structure The answer can be found in the Noble Qur’an
In the Name of Allah (God) Almighty The Most Gracious The Most Merciful
68. And your Lord inspired the bee, saying: "Take you habitations in the mountains and in the trees and in what they erect. The Noble Qur’an (16: 68)
Why does Allah (God) Almighty mention certain creatures in ?(.The Noble Qur’an (like for example, camels, bees, etc
To encourage people to think and ponder about these creatures and to learn from their design and function
Bees A Living System
http://ag.arizona.edu/pubs/insects/ahb/inf3.html
Bee hives handle the following: 2. The weight of the bees 3. Vibrations produced by the bees
Stiff material (wax)
Hexagonal arrangement of bee hives
Soft material (Honey)
http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm
The Miracles of Knowledge Found in the Hexagonal Design of Structures
The hexagonal structure is the optimal design for the distribution of matter
Covering maximum volume with minimum amount of material
The hexagonal structure is the optimal design to construct structures with, which ensures the following:
Complete stability Prevention of structural failure
Cell cytoskeleton
HIV virus
Structure of Ice water
http://www.sbu.ac.uk/water/ice1h.html
HIV virus
Manufacturing process needs the following: Factory Raw materials needed for products
(Earth (The Soil
بسم ال الرحمن الرحيم
سورة الحج
Analysis of Elements Found in The Soil
Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C) Calcium (Ca) Phosphorus (P) Potassium (K) Sulfur (S) Sodium (Na) Chlorine (Cl) Magnesium (Mg)
Iodine (I) Ferrous (Fe) Copper (Cu) Silicon (Si)
Elements Comprising The Basic Building Blocks of the Human Body (i.e. Amino Acids)
Elements in The Soil
Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C)
Elements Comprising Amino Acids Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C)
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
The Use of the Elements Found in The Soil In the Physiological Functions of The Human Body
Sodium (Na) and Potassium (K) are used in the transmission of neural signals Calcium (Ca) is used in cell signaling and muscle function Ferrous (Fe) is used in mass bio-transport in the human body Phosphorus (P) is used in the construction of bone material Iodine (I) is needed for healthy functioning of glands Chlorine (Cl) is used to maintain fluids balance Copper (Cu) is used in the transmission of electrical signals Silicon (Si) is a constructional material in the human body Sulfur (S) is used in muscular proteins Magnesium (Mg) is used in the construction of bone material
Perfect correlation between the elements found in the soil and those found in the human body
Constructional Material (Amino Acids)
Hydrogen (H) Nitrogen (N) Oxygen (O) Carbon (C)
Functional Material
Calcium (Ca) Phosphorus (P) Potassium (K) Sulfur (S) Sodium (Na) Chlorine (Cl) Magnesium (Mg) Iodine (I) Ferrous (Fe) Copper (Cu) Silicon (Si)
Amino acids http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
Alanine
Proline
Valine
Manufacturing process needs the following:
Factory
Supply Lines To take factory products
Raw materials needed for products
To supply the factory with raw materials
Blood Circulatory System Delivering amino acids to the (cells (factories
Projections that absorb water and nutrients in humans
Inside the Cells ((Factory ?What is needed there
Manufacturing process needs the following:
Factory
Raw materials needed for products
Supply Lines Information that contains the engineering design for the products to be manufactured
What is the word in ?the cell Storing of information using a geometrical code
The word of Allah (God) Almighty for creation is found in the DNA molecule Storing information using a geometric code
In the Name of Allah (God) Almighty The Most Gracious The Most Merciful
The Noble Qur’an (82: 8)
8. In whatever form Allah (God) Almighty willed He assembled you together
Allah (God) Almighty describes that the human body is made in a process of assembly
Thus there is a need for the information which describes the sequence and number of the basic units to be assembled
This information is the word of Allah (God) Almighty for creation (Be and it is)
DNA molecule
Tortora and Grabowski, 1996
http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
Amino acids
Every three geometrical units codes for one amino acid DNA Molecule
Amino Acids
The word for the creation of collagen protein (Storing of Information using a geometrical code)
+ Assembly of amino acids in a specific type, number, and sequence to create proteins
The Manufacturing of Proteins within the Human Body
Collagen type V sequence The Word of Allah (God) Almighty to create The Collagen Protein
Start codon
AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC
The production of collagen proteins within the human body
مركب الكولجين
Tortora and Grabowski, 1996
Sequence for Elastin Molecule The Word of Allah (God) Almighty to create The Elastin Protein
1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg 121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg 901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881 ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg
In the Name of Allah (God) Almighty The Most Gracious The Most Merciful
The Noble Qur’an (18: 109)
109. Say (O Muhammad peace be upon Him to mankind). "If the sea were ink for (writing) the Words of my Lord, surely, the sea would be exhausted before the Words of my Lord would be finished, even if we brought (another sea) like it for its aid."
The human body is created in a process of assembly
The Manufacturing (Creation) of The Human Body
The Manufacturing (Creation) of The Human Body
Basic units needed for the manufacturing process
Allah (God) Almighty links them together and products are created (products needed for the assembly of the human body)
The Basic Units needed for The Manufacturing (Creation) of The Human Body Amino Acids
Amino Acids http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html
DNA molecule
Tortora and Grabowski, 1996
The Words of Allah (God) Almighty for the Creation of The Human Body Information needed for the assembly of collagen protein
The rope that contains the information for the assembly of each component of the human body Information needed for the assembly of elastin protein
DNA Molecule DNA Molecule
Amino Acids
The word for the creation of collagen protein (Storing of Information using a geometrical code)
+ Assembly of amino acids in a specific type, number, and sequence to create proteins
Manufacturing process needs the following:
Factory
Raw materials needed for products
Supply Lines Information that contains the engineering design for the products to be manufactured
DNA Molecule
The Cell
Manufacturing process needs the following: Information that contains the engineering design for the products to be manufactured
Factory Raw materials needed for products
Supply Lines
Assembly Line
Assembly Line in the Cell
Manufacturing process needs the following: Information that contains the engineering design for the products to be manufactured
Assembly Line
Factory Raw materials needed for products
Supply Lines Workers to transport raw materials to the assembly line
Workers in the Cell
Manufacturing process needs the following: Information that contains the engineering design for the products to be manufactured
Assembly Line
Factory Raw materials needed for products
Supply Lines
A messenger to transport information to the assembly line
The Cell
Manufacturing process needs the following: Information that contains the engineering design for the products to be manufactured
Factory Raw materials needed for products
Assembly Line A messenger to transport information to the assembly line
Supply Lines
Energy to activate the assembly line
The Cell
Carbon Dioxide
Heat
Water
Oxygen
Glucose (Sugar)
The manufacturing process needs:
Assembly Line To take factory products
To supply the factory with raw materials
Transporting Factory Products Using Blood Circulatory System
Transporting Carbon Dioxide to the Lungs
Transporting Excess Water to the Kidneys
Transporting Heat from The Cells to The Skin Using Blood Circulatory System
Wind flow on human skin
Human Skin
http://www.chem.boun.edu.tr/FacultyStaff/TerezaVarnali/TVFolder/Deri/skinsec.h
Hexagonal arrangement of hair on human skin
Hair
Human Skin
Hexagonal arrangement of hair on human skin
Hair
The pattern wind makes on human skin with hair
The Importance of The Hexagonal Arrangement of Hair Produces
a pattern of wind flow exactly like the flow of water waves It generates turbulence on the surface of the skin Removal of heat with maximum efficiency
The manufacturing process follows the following steps: Information is read by a messenger to assemble the products Basic raw materials needed for assembly are selected Assembly line is activated Workers start to carry raw materials to the assembly line Raw materials are assembled together to create the product
Collagen type V sequence The Word of Allah (God) Almighty to create The Collagen Protein
Start codon
AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC
The Manufacturing of Proteins within the Human Body
The production of collagen proteins within the human body
مركب الكولجين
Tortora and Grabowski, 1996
The human body is created in a process of assembly
Sequence for Elastin Molecule The Word of Allah (God) Almighty to create The Elastin Protein
1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc catcccgcgc agcctggagg ggttccagga gctgtgcctg 121 gcggacttcc tggtggagtt cccggtggag tctattatcc aggggctggt attggaggcc 181 tgggaggagg aggaggagct ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241 ttctgggaac gtttggagca ggtcctggag gacttggagg tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc accttcccag gggcaggagc tctggtgccc gggggagcag 361 caggggctgc tgcggcttat aaagctgccg ccaaagctgg ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt ggcgttggtg gagttccagg tggtgttgga gttggcggag 481 tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601 gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg ttccctggtg tgggggtgct ccctggagtt cccactggca 721 caggagtcaa agccaaggct ccaggtggag gtggtgcttt tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841 tgccaggtgg ctacggactg ccctatacca atgggaaatt gccctatgga gtagctggtg 901 cagggggcaa ggctggctac ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961 cagctaaagc agccaagtat ggtgctgggg gagctggagt cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081 ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201 gtggcattcc tggtgttggt ggcatcccag gtgttggggg ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321 ctgccaaata cggagccaga ggtggagttg gcatcccgac atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441 ctgctgccgc cgccaaagct gctaagtatg gtgctggagg agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401 taggagccag gccattccca ggtggaggag ttgcagcaag acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521 atggaggagc ccttggagcc ctgggatacc aaggtggggg ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct tctggggacc cctgactcgc gacctcatca acgttggtgc 2641 tactgcttgg tggagaatgt aaaccttcta tgaccacccc ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761 cagcagcagc catgcagccc taaccagaaa ctccccccac cctatatcag aggccagggc 2821 gggtgtccca tctcttccca cccaggagct cccccccaca gtctccatct ccaagggaaa 2881 ttggtgctac atgttggtgc ttcttctttg tggggggagg gaggagggaa gggtatccca 2941 ggggggattg cccccttccc tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001 agtcccacct ccccctgccc accaggagcc attcctggct gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg gatttggtga catgatccct ctctctttgg ttcccctgtc 3121 cctgcctcct gttacctaaa gctacttccc acatctggga caccctggag tcagatggct 3181 cctcacactg ggaatagctc ccttgttctt atggaatcca cctgccatcc acccatccac 3241 ctactcatcc atccatccat ccatccatcc atccgtccat cttgactgcc tagtaccact 3301 aagctggctg ggcataccca ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361 ccccaccaca caccccgatc ctggcctagg gtgcaaaggg ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc cgttcttcct ggagccactc ttacagagca tgtctcacca 3481 ccccacctct ttgtgtttcg ctgtgataga tcaataaaat attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga ttgttggtgt gctctttggg tttatttttg tggctaattg 3601 gggagagaga gagagaaaaa aaaatttcta atctggggag ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721 cgaaataaga aaagagaatt aattgctcta gcaatgacta ataaatataa actttttaaa 3781 gg
كلم ال عز و جل لخلق المركبّات في نحلة tggtgccagg tgcagtacca ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561 gtggagtgcc aggagcaggt acccctgcag ctgcagctgc tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681 ggattcccgg tggagttggt gttggtgggg ttcctggtgg agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801 ctgctgctaa ggcagctgcc aaagcccagt acagagctgc cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921 gatttggggc tggtgctggt gtccccggat ttggggctgg tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041 gtggccttgg tggccctgga ggtctcggtg gccctggagg tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc ggtagagtag caggagctgc accccctgct gctgccgctg 2161 ctgctgccaa agctgctgct aaggctgccc agtatggcct tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc ggtggactgg gagccggtgg actgggagct ggtggactgg 2281 gagccggtgg actgggagct ggtggactgg gagccggtgg actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401
يقرأ كلم ال عز و جل لخلق المركّب
http://www.ars.usda.gov/is/graphics/photos/k7585-1.htm
Every manufacturing process needs:
A signal to start and stop production
How does the cell know when to start producing ?proteins )و ترى الرض هامدة فإذا أنزلنا عليها الماء اهتزت و ربت( صدق ال العظيم
Need a stimulating signal which can be:
Mechanical: by deformations of the cytoskeleton of the cell Electrical: AC electric current Magnetic: Varying magnetic field Fluidic: Oscillating flow Hormonal: proteins that work on the surface of the cell stimulating the production of a certain protein
Mechanical and electrical stimulation of cells Mechanical stimulation
Electrical stimulation
Electrons
Mechanical and electrical stimulation of cells Fluidic stimulation
Hormonal stimulation Hormone
Ca flux
Every manufacturing process needs: A signal to start and stop production
How is the signal for starting and stopping production generated?
How is the signal for starting and stopping production generated?
Staring signal is generated when there is a need for the product When there is a need for new collagen and hydroxy apatite for example
Osteocytes Monitoring bone displacements
Internal Design of Bone
Increase in bone displacements due to an increase in muscle tension
Stimulation signal to start bone production An increase in the magnetic field generated from collagen molecules
Vibratory magnetic field is the stimulation signal for osteoblasts cells
Production of new collagen and hydroxy apatite crystals
How is the signal for starting and stopping production generated?
Stopping signal is generated when there is no need for the product When there is no need for new collagen and hydroxy apatite for example
Decrease in bone displacements due to increase bone mass
Stopping signal to stop bone production A decrease in the magnetic field generated from collagen molecule
Reduction in vibratory signal seen by bone cells
Stopping the production of new bone material
Every manufacturing process needs:
Quality Control
Manufacturing collagen molecule by reading of Allah (God) Almighty words
مركب الكولجين
Tortora and Grabowski, 1996
In the Name of Allah (God) Almighty The Most Gracious The Most Merciful
282. So be afraid of Allah (God); and Allah (God) teaches you. And Allah (God) is the All-Knower of each and everything. The Noble Qur’an (2: 282)
Be a God fearing person
And Allah (God) will teach you i.e. Allah (God) Almighty will increase you from His knowledge and the knowledge of Allah (God) Almighty is found in the Noble Qur’an
Allah (God) Almighty did not mention a source of knowledge besides the Noble Qur’an
In The Name of Allah (God) The Most Compassionate The Most Merciful
The Noble Qur’an (17: 82)
82. Allah
(God) sends down the Qur’an that is healing and mercy to those who believe and it increases the wrong-doers nothing but loss.
Dr. Zaid Kasim Ghazzawi For detailed information please visit my Website at:
www.quranmiracle.com
E-mail:
[email protected] m